 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 20, 2015 |
| Title |
pKO-H3K4me3_RA |
| Sample type |
SRA |
| |
|
| Source name |
Haunt pKO mES cells
|
| Organism |
Mus musculus |
| Characteristics |
sample type: Haunt knock out in 46C cells
treatment: LIF withdrawal, 2uM RA, day1
strain: 129/Ola
chirp probes: none
genotype: Haunt pKO
cell line: 46C
cell type: embryonic stem cells
chip antibody: H3K4me3 (Abcam, ab8580)
barcode: GTACCTT
|
| Treatment protocol |
Cells were washed once with cold PBS, then harvested by trypsin digestion.
|
| Growth protocol |
Wild-type ESCs or Haunt KO ESCs were maintained in strandard ES medium supplemented with 15% heat-inactivated FCS, 1% of nucleoside mix (100 × stock, Millipore), Penicillin-Streptomycin Solution (100 × stock, Life Technologies), 2 mM Glutamax (100 × Life Technology), 0.1 mM non-essential amino acid, 0.1 mM 2-mercaptoethanol. Treat with 2mM RA and without LIF. Harvest cell at day 1 of RA treatment
Wild-type ESCs or Haunt KO ESCs were maintained in strandard ES medium supplemented with 15% heat-inactivated FCS, 1% of nucleoside mix (100 × stock, Millipore), Penicillin-Streptomycin Solution (100 × stock, Life Technologies), 2 mM Glutamax (100 × Life Technology), 0.1 mM non-essential amino acid, 0.1 mM 2-mercaptoethanol and supplied with 1000 U/ml recombinant leukemia inhibitory factor (LIF, millipore).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
ChIP was done following previously protocol (Shen, 2008). Briefly, cell were crosslinked on plate with 0.9% FMA for 10 min, then quenched by 1/20 volume of 2.5 M glycine. after two times of ice cold PBS wash, cell were harvested by trypsin digestion, and lysis by 1 x nuclei lysis buffer. Then Sonicated into average size 200-500 bp. 14000rpm for 15 min, supernatant were diluted by ChIP dilution buffer. 3 ug H3K4me3 (Abcam, ab8580) or H3K27me3 antibodies (Millipore, #07-449) were added, 4℃, end to end rotate overnight. 30 ul Protein AG UltraLink Resin (Thermo, 53133) were added, 4℃, end to end rotate for 3 times. after thoroughly wash, the DNA were eluted by elution buffer with protease K at 65℃.
The library was constructed by library preparation modules (New England Biolabs) according to manufacturer's instructions. Briefly, ChIRP retrieved DNA was end repaired, and dA-tailed by respect module according to respect instruments. The DNA product then ligated with adaptor with NEBNext Quick Ligation Module. The adaptor for the libary were sythersized from IDT with the first 7nt is "GTACCTT" as a barcode. After liagation, the DNA were amplified by primer 1.0 (AATGATACGGCGACCACCGAGATCTACAC, synthersized from IDT) and 2.0 (CAAGCAGAAGACGGCATACGAGAT, synthersized from IDT) for 15 cycles. After this, the product was further purified and size selected by Ampure XP beads (Beckman Coulter). The library was sequenced on the Genome Analyzer following the manufacturer's protocols.
Total RNA of RNA-Seq were extracted by TRIzol reagent according to manufacturer's instruction. mRNA were further isolated by Dynabeads mRNA purification kit (Life Technologies) according to manufacturer's instruction.
Libraries were prepared by illumina TruSeq Stranded mRNA LT Sample Prep Kit (RS-122-2101) according to the standard protocols of the manufacturer. ChIRP retrieved DNA-seq were prepared by library preparation modules (New England Biolabs) according to manufacturer's instructions.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Basecalls performed using CASAVA version
ChIRP retrived DNA-Seq reads were aligned to the mm9 genome assembly using Bowtie version 1.0.0 with the default parameters
RNA-seq reads were aligned to the mm9 genome assembly using Tophat v2.0.11,allowing for uniquely mapped reads and mapping both spliced and unspliced reads.
FPKM was calculated by Cufflink 2.1.1
Peaks of each sample were called using MACS v. 1.4.2
Genome_build: mm9
Supplementary_files_format_and_content: tab-delimited text files include RPKM values for wild-type or Haunt KO Samples, bedgraph files were generated using MACS v. 1.4.2, including peaks called by default parameters.
|
| |
|
| Submission date |
Feb 09, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
jinlong lu |
| E-mail(s) |
bioyuyang@hotmail.com
|
| Phone |
5853098469
|
| Organization name |
University of Rochester
|
| Lab |
Gorbunova & Seluanov Labs
|
| Street address |
213 Hutchinson Hall
|
| City |
Rochester |
| State/province |
NY |
| ZIP/Postal code |
14627 |
| Country |
USA |
| |
|
| Platform ID |
GPL17021 |
| Series (1) |
| GSE58514 |
Opposing roles for the lncRNA Haunt and its genomic locus in regulating HOXA gene activation during embryonic stem cell differentiation |
|
| Relations |
| BioSample |
SAMN03333438 |
| SRA |
SRX869307 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1604260_histone_B4.bigWig |
38.9 Mb |
(ftp)(http) |
BIGWIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
