NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1570252 Query DataSets for GSM1570252
Status Public on May 27, 2015
Title Naked-gDNA_control_1
Sample type SRA
 
Source name Replicate#1:naked gDNAs from control-treated rosette leaves
Organism Arabidopsis thaliana
Characteristics cultivar: Columbia-0
tissue: rosette leaves
Treatment protocol 4-week-old plants (before bolting) wre treated with 5 μM coronatine (COR) or water (control) for 1 hr
Growth protocol Arabidopsis thaliana Col-0 seeds were imbibed in water at 40C in darkness for 4 days for stratification, grown on soil (Arabidopsis mix) under long-day conditions (16 h of light/8 h of dark) at a fluence rate of 100 μmol/m2/s1 and watered with ½ strength Hoagland nutrient solution once per week (otherwise with deionized water).
Extracted molecule genomic DNA
Extraction protocol To assess the effect of environmental stimuli on nucleosome occupancy, plants were treated with coronatine (COR) (Sigma, St. Louis, MO) or water (control) for 1 hr. The harvested samples were ground with liquid nitrogen and divided into 3 aliquots for nucleosome genomic DNA (gDNA), naked gDNA, and RNA isolation. For isolating nucleosome gDNA, the nuclei were purified from one aliquot with nuclei extraction buffer (10 mM Hepes (pH 7.6), 5mM potassium chloride, 5 mM magnesium chloride, 1 M sucrose, 14 mM β-mercaptoethanol, 0.6% Triton-X 100, 0.4 mM phenylmethanesulfonyl fluoride, 1x ethylenediaminetetraacetic acid-free protease inhibitor (Roche, Mannheim, Germany)), digested with 0.4 U/μl micrococcal nuclease (MNase) (NEB, MA, USA) for 9 min, and purified with phenol/chloroform. To generate the naked gDNA sample, the gDNA was isolated without the nucleus isolation step as described previously (Dellaporta et al. 1983), purified with phenol/chloroform to strip off proteins, and digested with 0.25 U/μl MNase (NEB, MA, USA) for 1.75 or 3 min. Total RNA was purified with the E.Z.N.A. Plant RNA kit (Omega Bio-Tek, GA, USA)
The purified nucleosome and naked gDNA was used to construct a library for 50-bp paired-end sequencing following the Illumina protocol. The purified total RNA was used to construct a library for 50-bp single-end sequencing following the Illumina protocol.
 
Library strategy MNase-Seq
Library source genomic
Library selection MNase
Instrument model Illumina HiSeq 2500
 
Description Adaptor sequence: 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
Data processing Adaptor sequences were trimmed from the sequence reads. Adaptor sequences is for TrueSeq-3.
Naked and nucleosome reads were mapped to the genome through Bowtie with options (-m 1 -X 1000; otherwise with default) . To focus on the analysis of mono-nucleosome protected sequences, MNase-seq reads from nucleosome-protected or naked gDNA were further analyzed if the fragment size (distance between PE reads) was between 140-170 bp. The mapped reads from 2 replicates of nuclesome gDNAs were combined for the downstream analyses. For each nucleotide in the genome, the degree of nucleosome occupancy was represented by the Nucleosome Occupancy (NOC) score that is the number of reads mapped to the position in question divided by the total mapped reads per million for each sample.
genome_build: Reference genome dataset was retrieved from The Arabidopsis Information Resources (TAIR10; http://www.arabidopsis.org).
processed_data_files_format_and_content: The "Processed data_nucleosome_occupancy" is bed file that contains the Nucleosome Occupancy (NOC) score of each nucleotide in the genome for 3 samples (Nucleosome-gDNA_control,Nucleosome-gDNA_COR and Naked-gDNA_control).
 
Submission date Dec 19, 2014
Last update date May 15, 2019
Contact name Ming-Jung Liu
E-mail(s) mjliu@gate.sinica.edu.tw
Organization name Academia sinica
Street address 128 Sec. 2, Academia Rd, Nankang
City Taipei
ZIP/Postal code 11529
Country Taiwan
 
Platform ID GPL17639
Series (1)
GSE64397 Determinants of nucleosome positioning and their influence on plant gene expression
Relations
BioSample SAMN03271517
SRA SRX819523

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap