GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1570250

Query DataSets for GSM1570250

Status

Public on May 27, 2015

Title

Nucleosome-gDNA_COR_1

Sample type

SRA

Source name

Replicate#1:nucleosome-protected gDNAs from coronatine-treated rosette leaves

Organism

Arabidopsis thaliana

Characteristics

cultivar: Columbia-0
tissue: rosette leaves

Treatment protocol

4-week-old plants (before bolting) wre treated with 5 μM coronatine (COR) or water (control) for 1 hr

Growth protocol

Arabidopsis thaliana Col-0 seeds were imbibed in water at 40C in darkness for 4 days for stratification, grown on soil (Arabidopsis mix) under long-day conditions (16 h of light/8 h of dark) at a fluence rate of 100 μmol/m2/s1 and watered with ½ strength Hoagland nutrient solution once per week (otherwise with deionized water).

Extracted molecule

genomic DNA

Extraction protocol

To assess the effect of environmental stimuli on nucleosome occupancy, plants were treated with coronatine (COR) (Sigma, St. Louis, MO) or water (control) for 1 hr. The harvested samples were ground with liquid nitrogen and divided into 3 aliquots for nucleosome genomic DNA (gDNA), naked gDNA, and RNA isolation. For isolating nucleosome gDNA, the nuclei were purified from one aliquot with nuclei extraction buffer (10 mM Hepes (pH 7.6), 5mM potassium chloride, 5 mM magnesium chloride, 1 M sucrose, 14 mM β-mercaptoethanol, 0.6% Triton-X 100, 0.4 mM phenylmethanesulfonyl fluoride, 1x ethylenediaminetetraacetic acid-free protease inhibitor (Roche, Mannheim, Germany)), digested with 0.4 U/μl micrococcal nuclease (MNase) (NEB, MA, USA) for 9 min, and purified with phenol/chloroform. To generate the naked gDNA sample, the gDNA was isolated without the nucleus isolation step as described previously (Dellaporta et al. 1983), purified with phenol/chloroform to strip off proteins, and digested with 0.25 U/μl MNase (NEB, MA, USA) for 1.75 or 3 min. Total RNA was purified with the E.Z.N.A. Plant RNA kit (Omega Bio-Tek, GA, USA)
The purified nucleosome and naked gDNA was used to construct a library for 50-bp paired-end sequencing following the Illumina protocol. The purified total RNA was used to construct a library for 50-bp single-end sequencing following the Illumina protocol.

Library strategy

MNase-Seq

Library source

genomic

Library selection

MNase

Instrument model

Illumina HiSeq 2500

Description

Adaptor sequence: 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCGTCTTCTGCTTG

Data processing

Adaptor sequences were trimmed from the sequence reads. Adaptor sequences is for TrueSeq-3.
Naked and nucleosome reads were mapped to the genome through Bowtie with options (-m 1 -X 1000; otherwise with default) . To focus on the analysis of mono-nucleosome protected sequences, MNase-seq reads from nucleosome-protected or naked gDNA were further analyzed if the fragment size (distance between PE reads) was between 140-170 bp. The mapped reads from 2 replicates of nuclesome gDNAs were combined for the downstream analyses. For each nucleotide in the genome, the degree of nucleosome occupancy was represented by the Nucleosome Occupancy (NOC) score that is the number of reads mapped to the position in question divided by the total mapped reads per million for each sample.
genome_build: Reference genome dataset was retrieved from The Arabidopsis Information Resources (TAIR10; http://www.arabidopsis.org).
processed_data_files_format_and_content: The "Processed data_nucleosome_occupancy" is bed file that contains the Nucleosome Occupancy (NOC) score of each nucleotide in the genome for 3 samples (Nucleosome-gDNA_control,Nucleosome-gDNA_COR and Naked-gDNA_control).

Submission date

Dec 19, 2014

Last update date

May 15, 2019

Contact name

Ming-Jung Liu

E-mail(s)

mjliu@gate.sinica.edu.tw

Organization name

Academia sinica

Street address

128 Sec. 2, Academia Rd, Nankang