 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 27, 2015 |
| Title |
Nucleosome-gDNA_control_2 |
| Sample type |
SRA |
| |
|
| Source name |
Replicate#2:nucleosome-protected gDNAs from water-treated rosette leaves
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
cultivar: Columbia-0 tissue: rosette leaves
|
| Treatment protocol |
4-week-old plants (before bolting) wre treated with 5 μM coronatine (COR) or water (control) for 1 hr
|
| Growth protocol |
Arabidopsis thaliana Col-0 seeds were imbibed in water at 40C in darkness for 4 days for stratification, grown on soil (Arabidopsis mix) under long-day conditions (16 h of light/8 h of dark) at a fluence rate of 100 μmol/m2/s1 and watered with ½ strength Hoagland nutrient solution once per week (otherwise with deionized water).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
To assess the effect of environmental stimuli on nucleosome occupancy, plants were treated with coronatine (COR) (Sigma, St. Louis, MO) or water (control) for 1 hr. The harvested samples were ground with liquid nitrogen and divided into 3 aliquots for nucleosome genomic DNA (gDNA), naked gDNA, and RNA isolation. For isolating nucleosome gDNA, the nuclei were purified from one aliquot with nuclei extraction buffer (10 mM Hepes (pH 7.6), 5mM potassium chloride, 5 mM magnesium chloride, 1 M sucrose, 14 mM β-mercaptoethanol, 0.6% Triton-X 100, 0.4 mM phenylmethanesulfonyl fluoride, 1x ethylenediaminetetraacetic acid-free protease inhibitor (Roche, Mannheim, Germany)), digested with 0.4 U/μl micrococcal nuclease (MNase) (NEB, MA, USA) for 9 min, and purified with phenol/chloroform. To generate the naked gDNA sample, the gDNA was isolated without the nucleus isolation step as described previously (Dellaporta et al. 1983), purified with phenol/chloroform to strip off proteins, and digested with 0.25 U/μl MNase (NEB, MA, USA) for 1.75 or 3 min. Total RNA was purified with the E.Z.N.A. Plant RNA kit (Omega Bio-Tek, GA, USA) The purified nucleosome and naked gDNA was used to construct a library for 50-bp paired-end sequencing following the Illumina protocol. The purified total RNA was used to construct a library for 50-bp single-end sequencing following the Illumina protocol.
|
| |
|
| Library strategy |
MNase-Seq |
| Library source |
genomic |
| Library selection |
MNase |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Adaptor sequence: 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATGCCGTCTTCTGCTTG
|
| Data processing |
Adaptor sequences were trimmed from the sequence reads. Adaptor sequences is for TrueSeq-3. Naked and nucleosome reads were mapped to the genome through Bowtie with options (-m 1 -X 1000; otherwise with default) . To focus on the analysis of mono-nucleosome protected sequences, MNase-seq reads from nucleosome-protected or naked gDNA were further analyzed if the fragment size (distance between PE reads) was between 140-170 bp. The mapped reads from 2 replicates of nuclesome gDNAs were combined for the downstream analyses. For each nucleotide in the genome, the degree of nucleosome occupancy was represented by the Nucleosome Occupancy (NOC) score that is the number of reads mapped to the position in question divided by the total mapped reads per million for each sample. genome_build: Reference genome dataset was retrieved from The Arabidopsis Information Resources (TAIR10; http://www.arabidopsis.org). processed_data_files_format_and_content: The "Processed data_nucleosome_occupancy" is bed file that contains the Nucleosome Occupancy (NOC) score of each nucleotide in the genome for 3 samples (Nucleosome-gDNA_control,Nucleosome-gDNA_COR and Naked-gDNA_control).
|
| |
|
| Submission date |
Dec 19, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Ming-Jung Liu |
| E-mail(s) |
mjliu@gate.sinica.edu.tw
|
| Organization name |
Academia sinica
|
| Street address |
128 Sec. 2, Academia Rd, Nankang
|
| City |
Taipei |
| ZIP/Postal code |
11529 |
| Country |
Taiwan |
| |
|
| Platform ID |
GPL17639 |
| Series (1) |
| GSE64397 |
Determinants of nucleosome positioning and their influence on plant gene expression |
|
| Relations |
| BioSample |
SAMN03271509 |
| SRA |
SRX819520 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |