NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1558511 Query DataSets for GSM1558511
Status Public on Dec 05, 2014
Title Sox9_2/IgG_2
Sample type genomic
 
Channel 1
Source name SOX9 ChIP DNA from embryonic day 13 gonads
Organism Rattus norvegicus
Characteristics developmental stage: Embryonic day 13 (E13)
strain: Harlan Sprague-Dawley
tissue: gonads
Treatment protocol SOX9-experimental
Growth protocol Harlan Sprague-Dawley rats were used for the study. All the rats were kept in a temperature controlled environment and given food and water ad libitum. Estrous cycles of female rats were monitored by cellular morphology from vaginal smears. Rats in early estrus were paired with males overnight and mating confirmed by sperm positive smears, denoted day 0 of pregnancy. Pregnant rats were euthanized at embryonic day 13 (E13) of pregnancy, and embryonic gonads were collected for chromatin immunoprecipitation.
Extracted molecule genomic DNA
Extraction protocol Harlan Sprague-Dawley rats were used for the study. All the rats were kept in a temperature controlled environment and given food and water ad libitum. Estrous cycles of female rats were monitored by cellular morphology from vaginal smears. Rats in early estrus were paired with males overnight and mating confirmed by sperm positive smears, denoted day 0 of pregnancy. Pregnant rats were euthanized at embryonic day 13 (E13) of pregnancy, and embryonic gonads were collected for chromatin immunoprecipitation. Sex was determined by PCR using primers specific for Sry on genomic DNA isolated from embryo tails was preformed by using 1 μl of genomic DNA with the consensus SRY primers 5′ CGGGATCCATGTCAAGCGCC CCATGAATGCATTTATG 3′ and 5′ GCGGAATTCACTTTAGCCCTCCGATGAGGCTGA TAT 3′, producing a PCR product of 240 base pairs (bp). PCR was performed using an annealing temperature of 55°C for 30 cycles. All procedures were approved by the Washington State University Animal Care and Use Committee (IACUC approval # 02568-026). A modified ChIP (cChIP) assay was adopted from O'Neill et al., (2006) and performed according to Bhandari et al (2011). To run ChIP assay, male and female gonads (gonad+mesonephros) were dissected from approximately twenty to twenty five 13 dpc (12–18 tail somite stage) rat embryos per array and snap-frozen in liquid nitrogen. Drosophila SL2 cells were used as a carrier. Densely-grown cells (approximately 5×107 cells) were pelleted and washed three times in ice-cold PBS, 5 mM sodium butyrate and resuspended in 0.5 ml NB buffer (15 mM Tris-HCL, pH 7.4, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 0.5 mM 2-mercaptoethanol, 0.1 mM PMSF). Frozen testis samples were thawed, mixed with SL2 cells and homogenized to make single cell suspension. Nuclei were pelleted, resuspended in 20 ml NB buffer, 5% (vol/vol) sucrose, pelleted and resuspended again in 5 ml digestion buffer (50 mM Tris-HCl pH 7.4, 0.32 M sucrose, 4 mM MgCl2, 1 mM CaCl2, 0.1 mM PMSF). Following micrococcal nuclease digestion (NEB, USA) for 10 minutes at 37 degree, the digested samples were gently spun (800×g) for 10 minutes and supernatant set aside on ice. The pellet was resuspended in 250 ul incubation buffer (50 mM Nacl, 20 mM Tris HCl pH 7.5, 20 mM Na-butyrate, 5 mM Na2EDTA, and 0.1 mM PMSF) and again centrifuged gently for 10 minutes. Both the supernatants were pooled and a fraction (50 ul) out of it was kept aside to use as input. The remaining supernatant was incubated with either non-immune IgG or anti-SRY or anti-Gata4 antibodies at 4°C overnight. After incubation with 100 µl of preswollen protein A-Sepharose beads (Sigma) for 2 h at 4°C, the bead-bound immunoprecipitates were centrifuged gently and washed five times with wash buffer (50 mM TrisHCl pH 7.5, 10 mM EDTA, 5 mM Na butyrate and 50–150 mM NaCl). The protein-DNA complexes were incubated at room temperature with elution buffer (1% SDS in TE) and centrifuged at 11500×g at 4°C for 10 minutes. Elution was repeated two times and eluted DNA was pooled. Co-immunoprecipitated DNA was purified by proteinase K digestion, phenol/chloroform extraction, and ethanol precipitation. Final concentration of immunoprecipitated DNA varied from 100 to 300 ng per assay. Two rounds of PCR reactions were run for 25 cycles before evaluating samples by gel electrophoresis. Identity of the PCR-amplified fragments was verified by sequencing. The conditions for the native-ChIP (not including cross linking) were optimized for immunoprecipitating with SRY and SOX9 antibodies. The native-ChIP was used to identify high affinity binding sites and reduce low affinity sites, and was validated with PCR for Sox9, Tcf21 and Ntf3. To run a replicate of the ChIP assay, at least twenty male gonads from thirty 13 dpc (12–18 tail somite stage) rat embryos were used per array. All three ChIP experiments were with different biological samples. Drosophila SL2 cells (American Type Culture Collection (ATCC) Catalog no. CRL-1963) were used as a carrier. Densely-grown cells (approximately 5×107 cells) were pelleted and washed three times in ice-cold phosphate buffered salve (PBS), 5 mM sodium butyrate and resuspended in 0.5 ml NB buffer (15 mM Tris-HCL, pH 7.4, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 0.5 mM 2-mercaptoethanol, 0.1 mM PMSF). Testis samples were mixed with SL2 cells and homogenized to make single cell suspension. Nuclei were pelleted, resuspended in 10 ml NB buffer, 5% (vol/vol) sucrose, pelleted and resuspended again in 1.5 ml digestion buffer (50 mM Tris-HCl pH 7.4, 0.32 M sucrose, 4 mM MgCl2, 1 mM CaCl2, 0.1 mM PMSF). Following micrococcal nuclease digestion (NEB, USA) for 5 minutes at 28°C, the digested samples were gently spun (800× g) for 15 minutes and supernatant set aside on ice. The pellet was resuspended in 250 ul digestion buffer and again centrifuged gently at 800× g for 15 minutes at 4 degrees. Both the supernatants were pooled and a fraction (50 ul) out of it was kept aside to use as input. The remaining supernatant was incubated with either non-immune IgG or anti-SRY (Santa Cruz, CA, USA) or anti-SOX9 (ABcam, CA, USA) antibodies at 4°C overnight. The specificity of these antibodies on western blots have been previously described and validated. After incubation with 100 µl of pre-swollen protein A-Sepharose beads (SL2 DNA blocked) for 2 h at 4°C, the bead-bound immunoprecipitates were centrifuged gently and washed five times with wash buffer (50 mM TrisHCl pH 7.5, 10 mM EDTA, 5 mM Na butyrate and 50–150 mM NaCl). The protein-DNA complexes were incubated at room temperature with elution buffer (1% SDS in TE) and centrifuged at 11500× g for 10 minutes. Elution was repeated two times and eluted DNA was pooled. Co-immunoprecipitated DNA was purified by phenol/chloroform extraction, and ethanol precipitation. Final concentration of immunoprecipitated DNA varied from 200 to 500 ng per assay. Three different experiments and ChIP assays were performed. Exactly 30 ng of immunoprecipitated DNA from each assay was amplified by whole genome amplification kit developed by Sigma (Sigma #WGA2 50 RXN). At least five separate whole genome amplifications were performed and DNA was pooled. Pooled whole genome amplified DNA was purified by using Promega's Wizard SV40 PCR cleanup kit (Promega). Purified DNA was checked on the gel and sent to Nimblegen for ChIP-chip hybridization (Nimblegen, Iceland).
Label Cy5
Label protocol SRY or SOX9 ChIP DNA where labeled with Cy5 and control DNA from IgG control were labeled with Cy3
 
Channel 2
Source name IgG ChIP DNA from embryonic day 13 gonads
Organism Rattus norvegicus
Characteristics developmental stage: Embryonic day 13 (E13)
strain: Harlan Sprague-Dawley
tissue: gonads
Treatment protocol IgG-Control
Growth protocol Harlan Sprague-Dawley rats were used for the study. All the rats were kept in a temperature controlled environment and given food and water ad libitum. Estrous cycles of female rats were monitored by cellular morphology from vaginal smears. Rats in early estrus were paired with males overnight and mating confirmed by sperm positive smears, denoted day 0 of pregnancy. Pregnant rats were euthanized at embryonic day 13 (E13) of pregnancy, and embryonic gonads were collected for chromatin immunoprecipitation.
Extracted molecule genomic DNA
Extraction protocol Harlan Sprague-Dawley rats were used for the study. All the rats were kept in a temperature controlled environment and given food and water ad libitum. Estrous cycles of female rats were monitored by cellular morphology from vaginal smears. Rats in early estrus were paired with males overnight and mating confirmed by sperm positive smears, denoted day 0 of pregnancy. Pregnant rats were euthanized at embryonic day 13 (E13) of pregnancy, and embryonic gonads were collected for chromatin immunoprecipitation. Sex was determined by PCR using primers specific for Sry on genomic DNA isolated from embryo tails was preformed by using 1 μl of genomic DNA with the consensus SRY primers 5′ CGGGATCCATGTCAAGCGCC CCATGAATGCATTTATG 3′ and 5′ GCGGAATTCACTTTAGCCCTCCGATGAGGCTGA TAT 3′, producing a PCR product of 240 base pairs (bp). PCR was performed using an annealing temperature of 55°C for 30 cycles. All procedures were approved by the Washington State University Animal Care and Use Committee (IACUC approval # 02568-026). A modified ChIP (cChIP) assay was adopted from O'Neill et al., (2006) and performed according to Bhandari et al (2011). To run ChIP assay, male and female gonads (gonad+mesonephros) were dissected from approximately twenty to twenty five 13 dpc (12–18 tail somite stage) rat embryos per array and snap-frozen in liquid nitrogen. Drosophila SL2 cells were used as a carrier. Densely-grown cells (approximately 5×107 cells) were pelleted and washed three times in ice-cold PBS, 5 mM sodium butyrate and resuspended in 0.5 ml NB buffer (15 mM Tris-HCL, pH 7.4, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 0.5 mM 2-mercaptoethanol, 0.1 mM PMSF). Frozen testis samples were thawed, mixed with SL2 cells and homogenized to make single cell suspension. Nuclei were pelleted, resuspended in 20 ml NB buffer, 5% (vol/vol) sucrose, pelleted and resuspended again in 5 ml digestion buffer (50 mM Tris-HCl pH 7.4, 0.32 M sucrose, 4 mM MgCl2, 1 mM CaCl2, 0.1 mM PMSF). Following micrococcal nuclease digestion (NEB, USA) for 10 minutes at 37 degree, the digested samples were gently spun (800×g) for 10 minutes and supernatant set aside on ice. The pellet was resuspended in 250 ul incubation buffer (50 mM Nacl, 20 mM Tris HCl pH 7.5, 20 mM Na-butyrate, 5 mM Na2EDTA, and 0.1 mM PMSF) and again centrifuged gently for 10 minutes. Both the supernatants were pooled and a fraction (50 ul) out of it was kept aside to use as input. The remaining supernatant was incubated with either non-immune IgG or anti-SRY or anti-Gata4 antibodies at 4°C overnight. After incubation with 100 µl of preswollen protein A-Sepharose beads (Sigma) for 2 h at 4°C, the bead-bound immunoprecipitates were centrifuged gently and washed five times with wash buffer (50 mM TrisHCl pH 7.5, 10 mM EDTA, 5 mM Na butyrate and 50–150 mM NaCl). The protein-DNA complexes were incubated at room temperature with elution buffer (1% SDS in TE) and centrifuged at 11500×g at 4°C for 10 minutes. Elution was repeated two times and eluted DNA was pooled. Co-immunoprecipitated DNA was purified by proteinase K digestion, phenol/chloroform extraction, and ethanol precipitation. Final concentration of immunoprecipitated DNA varied from 100 to 300 ng per assay. Two rounds of PCR reactions were run for 25 cycles before evaluating samples by gel electrophoresis. Identity of the PCR-amplified fragments was verified by sequencing. The conditions for the native-ChIP (not including cross linking) were optimized for immunoprecipitating with SRY and SOX9 antibodies. The native-ChIP was used to identify high affinity binding sites and reduce low affinity sites, and was validated with PCR for Sox9, Tcf21 and Ntf3. To run a replicate of the ChIP assay, at least twenty male gonads from thirty 13 dpc (12–18 tail somite stage) rat embryos were used per array. All three ChIP experiments were with different biological samples. Drosophila SL2 cells (American Type Culture Collection (ATCC) Catalog no. CRL-1963) were used as a carrier. Densely-grown cells (approximately 5×107 cells) were pelleted and washed three times in ice-cold phosphate buffered salve (PBS), 5 mM sodium butyrate and resuspended in 0.5 ml NB buffer (15 mM Tris-HCL, pH 7.4, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 0.5 mM 2-mercaptoethanol, 0.1 mM PMSF). Testis samples were mixed with SL2 cells and homogenized to make single cell suspension. Nuclei were pelleted, resuspended in 10 ml NB buffer, 5% (vol/vol) sucrose, pelleted and resuspended again in 1.5 ml digestion buffer (50 mM Tris-HCl pH 7.4, 0.32 M sucrose, 4 mM MgCl2, 1 mM CaCl2, 0.1 mM PMSF). Following micrococcal nuclease digestion (NEB, USA) for 5 minutes at 28°C, the digested samples were gently spun (800× g) for 15 minutes and supernatant set aside on ice. The pellet was resuspended in 250 ul digestion buffer and again centrifuged gently at 800× g for 15 minutes at 4 degrees. Both the supernatants were pooled and a fraction (50 ul) out of it was kept aside to use as input. The remaining supernatant was incubated with either non-immune IgG or anti-SRY (Santa Cruz, CA, USA) or anti-SOX9 (ABcam, CA, USA) antibodies at 4°C overnight. The specificity of these antibodies on western blots have been previously described and validated. After incubation with 100 µl of pre-swollen protein A-Sepharose beads (SL2 DNA blocked) for 2 h at 4°C, the bead-bound immunoprecipitates were centrifuged gently and washed five times with wash buffer (50 mM TrisHCl pH 7.5, 10 mM EDTA, 5 mM Na butyrate and 50–150 mM NaCl). The protein-DNA complexes were incubated at room temperature with elution buffer (1% SDS in TE) and centrifuged at 11500× g for 10 minutes. Elution was repeated two times and eluted DNA was pooled. Co-immunoprecipitated DNA was purified by phenol/chloroform extraction, and ethanol precipitation. Final concentration of immunoprecipitated DNA varied from 200 to 500 ng per assay. Three different experiments and ChIP assays were performed. Exactly 30 ng of immunoprecipitated DNA from each assay was amplified by whole genome amplification kit developed by Sigma (Sigma #WGA2 50 RXN). At least five separate whole genome amplifications were performed and DNA was pooled. Pooled whole genome amplified DNA was purified by using Promega's Wizard SV40 PCR cleanup kit (Promega). Purified DNA was checked on the gel and sent to Nimblegen for ChIP-chip hybridization (Nimblegen, Iceland).
Label Cy3
Label protocol SRY or SOX9 ChIP DNA where labeled with Cy5 and control DNA from IgG control were labeled with Cy3
 
 
Hybridization protocol The ChIP-Chip hybridization used a Roche Nimblegen's Rat ChIP-chip 3×720K RefSeq Promoter Array. The enrichment for each probe on the array was calculated as the log ratio of the intensities of hybridization for SRY or SOX9 ChIP DNA (Cy5) to control DNA from IgG control (Cy3). Array contained on average 4,000 bp of promoter for each of 15,287 promoters in the rat genome corresponding to 15,600 RefSeq transcripts (approximately 3880 bp upstream and 970 bp downstream from transcription start site). Two different comparative (ChIP vs ChIP) hybridizations experiments were performed, each encompassing 4 samples (2 treatment and 2 control) and 4 array sets. The first was a dye balance design as follows: C1 in the green channel against V1 in the red channel; V1 in the green channel against C2 in the red channel; C2 in the green channel against V2 in the red channel; V2 in the green channel against C1 in the red channel. The second one was a dye swap design as follows: C1 in the green channel against V1 in the red channel; V1 in the green channel against C1 in the red channel; C2 in the green channel against V2 in the red channel; V2 in the green channel against C2 in the red channel.
Scan protocol Scanning and image acquisition was performed in-house by Nimblegen Inc.
Description SOX9 experimental sample 2 is compared to IgG control sample 2
Data processing For each hybridization experiment raw data from both the Cy3 can Cy5 channels were imported into R (R Development Core Team (2010), R: A language for statistical computing, R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-07-0, URL http://www.R-project.org), and data checked for quality and converted to MA values (M = Cy5-Cy3; A = (Cy5+Cy3)/2). The R codes that were used for analysis and annotation are available in the following website: http//www.skinner.wsu.edu. All the tiling array Chip data was deposited in the NCBI GEO site. Within each array, probes were separated into groups by GC content and each group was separately normalized using the LOESS normalization procedure. This allowed for groups with optimal GC content, which exhibited a reduced quality issue, to receive a normalization curve specific to that group. After each array was normalized within array, the arrays were then normalized across arrays using the A-quantile normalization procedure. Following normalization the probe's normalized M values (and then A) were replaced with the median value of all probe M values (and then A) within a sliding window of 600 bp, due to the size of DNA fragments used. Following normalization each probe's M value represents the median intensity difference between Cy5 and Cy3 of a 600 bp window. Significance was assigned to probe differences between experimental (SRY or SOX9) and IgG control by calculating the median value of the intensity differences as compared to a normal distribution scaled to the experimental mean and standard deviation of M. Regions of interest were then determined by combining consecutive probes with significance p-values less than 10−3. Significance was assigned to probe differences between experimental and control by calculating the median value of the increasing differences as compared to a normal distribution scaled to the experimental mean and standard deviation of the mean. A Z-score and P-value were computed from that distribution with the use of R code analysis. The statistically significant peaks of hybridization were identified and P-value associated with each peak presented. Each peak of interest was then annotated for the gene. Every promoter exceeding the intensity threshold was considered positive for SRY or SOX9 binding. The final list of SRY or SOX9 targets includes the promoter-proximal regions that made the threshold in an average of the three replicates. Hybridization signals for all the candidate promoters that were within the cutoff line (p≤1×10−7) were plotted (average of the three replicates), Supplemental Figure S1. The genes that were not in the list but seemed to be masked by IgG negative signals were designated as questionable positives. These questionable positive promoters were manually chosen and confirmed by PCR, Supplemental Figure S2.
Nimblescan software-generated Cy3/Cy5 expression ratios are presented in the processed data files, but R-code data processing of raw data as described was used as the basis for conlusions in this study. Value definitions for processed data files: #ClusterID= ID and chrolosomal location for cluster of probes showing a significant difference (p<1.0E-5) between red and green channel hybridization (treated vs. control), #Chromosome= Chromosome number, #cSTART= Cluster start site, #cSTOP= Cluster stop site, #meanM= mean log2 intensity ratio (treated vs. control) across all microarray chips for this treatment/control group, #meanA= mean log2 hybridization intensity (both red and green channel) across all microarray chips for this treatment/control group, #minP= p-value for difference between treated and control intensity as calculated by indicated R-code from raw data files. P-value must be p<1.0E-5 or less for inclusion, #nProbes= number of consecutive probes with p<1.0E-5 included in cluster, #CG= CG content of cluster, #CpG= CpG content of cluster, and #CpGdensity= number of CpGs per hundred base pairs.
 
Submission date Dec 04, 2014
Last update date Dec 05, 2014
Contact name Michael K Skinner
E-mail(s) skinner@mail.wsu.edu
Organization name WSU
Department SBS
Street address Abelson 507
City Pullman
State/province WA
ZIP/Postal code 99163
Country USA
 
Platform ID GPL18610
Series (2)
GSE63855 Global Genome Analysis of the Downstream Binding Targets of Testis Determining Factor SRY and SOX9 [SOX9 ChIP]
GSE63856 Global Genome Analysis of the Downstream Binding Targets of Testis Determining Factor SRY and SOX9

Supplementary file Size Download File type/resource
GSM1558511_62149405_532.pair.gz 11.9 Mb (ftp)(http) PAIR
GSM1558511_62149405_635.pair.gz 11.9 Mb (ftp)(http) PAIR
Raw data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap