|
Status |
Public on Aug 08, 2014 |
Title |
cid14Δ |
Sample type |
SRA |
|
|
Source name |
fission yeast
|
Organism |
Schizosaccharomyces pombe |
Characteristics |
strain: CAF382 genotype/variation: cid14Δ
|
Growth protocol |
Logarithmically growing yeast cells in liquid YES media at 30°C, shaking at 150 rpm
|
Extracted molecule |
total RNA |
Extraction protocol |
Hot phenol RNA dextraction protocol (Schmitt ME, Brown TA & Trumpower BL (1990) A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucleic Acids Res. 18: 3091–3092) PNK treated total RNA was purified with the RNA clean and concentrator kit (Zymo Research). 120 pmol of 5’ phosphorylated 3’ RACE adapter oligonucleotide (cctatagtgagtcgtattaattctgtgctcgc(tdd)) were mixed with 3 µg of purified RNA and ligated with T4 RNA ligase as above. 1 µg of ligated RNA was reverse-transcribed with Superscript III (Invitrogen) using adapter-specific oligonucleotide (GCGAGCACAGAATTAATACGACT). cDNA was PCR-amplified with the Phusion High-Fidelity PCR kit (Thermo Scientific) and PCR products were sequenced. Primers to amlify U6 snRNA (acactctttccctacacgacgctcttccgatctgatcttcggatcactttggt + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg); Primers to amplify tagged U6 (acactctttccctacacgacgctcttccgatctgatcttcggatcactttgatcttcg + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg)
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
RACE |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
GQY30 PCR product corresponding to U6 snRNA was sequenced.
|
Data processing |
Basecalls performed using CASAVA version 1.8.2 Adapter sequences were removed using cutadapt Reads were aligned to the indicated reference sequence using BLAT version 35x1. If applicable, read pairs where any of the reads matches the intron were removed. Read pairs corresponding to full-length species were retained, and the terminal nucleotide sequence was extracted. The frequency of each terminal nucleotide sequence in the sample was computed. Supplementary_files_format_and_content: txt files containing the frequency of each terminal nucleotide sequence
|
|
|
Submission date |
Aug 07, 2014 |
Last update date |
May 15, 2019 |
Contact name |
Claus M Azzalin |
E-mail(s) |
claus.azzalin@bc.biol.ethz.ch
|
Organization name |
ETH Zürich
|
Department |
Institute of Biochemistry
|
Street address |
Otto-Stern-Weg 3
|
City |
Zürich |
ZIP/Postal code |
8093 |
Country |
Switzerland |
|
|
Platform ID |
GPL13988 |
Series (2) |
GSE60195 |
yeast U6 3' RACE |
GSE60198 |
The Mpn1 exonuclease defines a novel spliceosomal snRNA decay pathway dependent on Rrp6 and Lsm2-8 complex |
|
Relations |
BioSample |
SAMN02954371 |
SRA |
SRX671708 |