|
Status |
Public on Jan 01, 2007 |
Title |
STAT1 HeLa RenLab ENCODE PCR tiling array replicate 5 |
Sample type |
genomic |
|
|
Channel 1 |
Source name |
Chromatin immunoprecipitated DNA from HeLa cells using STAT1 antibody
|
Organism |
Homo sapiens |
Characteristics |
Chromatin immunoprecipitated DNA from HeLa cells using STAT1 antibody
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Three biological replicates of treated and untreated cells were crosslinked and harvested as previously described [Kim, T. H. et al. A high-resolution map of active promoters in the human genome. Nature 436, 876-80 (2005)] with the following modifications. Cells were crosslinked for 20 minutes at 37ºC in normal culture media plus 1/10 volume formaldehyde crosslinking solution in large culture plates, followed by glycine quenching and PBS wash at room temperature. Crosslinked cells were collected by scraping and centrifugation. Chromatin was isolated and fragmented as previously described, though generating fragments of 1.5 Kbp in length required 12 x 30 sec cycles of sonication.
|
Label |
Cy5
|
Label protocol |
One microgram (ug) of LM-PCR products were used for labeling and hybridization to each array. One microgram of immunoprecipitated or total genomic LM-PCR DNA was mixed with 40 uL of 1 uM Cy5 or Cy3 end labeled random prime nonamer oligonucleotides (TriLink Biotechnologies) respectively with the bacterial label control DNA in a total volume of 88 uL. The DNA and random primers were annealed by heating the sample to 98°C for 5 minutes and chilled quickly in ice water for 2-3 minutes. Two microliter of (100 units) of E. coli DNA polymerase Klenow fragment and 10 uL of 10 mM equimolar mixture of dATP, dTTP, dCTP, and dGTP were added to the annealed DNA sample and incubated at 37°C for 2 hours. The reaction was stopped by addition of 10 uL of 0.5 M EDTA. The labeled sample was ethanol precipitated by addition of 11uL 5 M NaCl and 110 uL isopropanol. The precipitate was collected by centrifugation and the resulting labeled DNA pellet was washed with 80% ethanol (V/V). The pellet was dried under vacuum for 5-15 minutes to remove any remaining liquid, and the resulting dry labeled DNA pellet was resuspended in 10 uL dH2O.
|
|
|
Channel 2 |
Source name |
Input DNA from HeLa cells
|
Organism |
Homo sapiens |
Characteristics |
Input DNA from HeLa cells
|
Extracted molecule |
genomic DNA |
Extraction protocol |
same as for Channel 1
|
Label |
Cy3
|
Label protocol |
same as for Channel 1
|
|
|
|
Hybridization protocol |
Hybridization procedure and parameters: Equal amounts (12 ug) of Cy5 and Cy3 labeled DNA samples were mixed, and 4 uL 2.94 nM Xenohybe control oligos (an equimolar mixture of 5'TTGCCGATGCTAACGACGCATCAGACTGCGTACGCCTAAGCAACGCTA3' and 5'CATTGCTGTGCGTACGCAGTCAAGTCGATCACGCTAACTCGTTGCGAC3') was added to the mixture. The sample was vacuum dried under low heat until the volume of sample was less than 14.4 uL. The final volume of DNA was adjusted to 14.4 uL with dH2O. To this sample, 11.25 uL 20X SSC, 18 uL 100% formamide, 0.45 uL 10% SDS, 0.45 uL 10X TE (100mM Tris, 10mM EDTA), and 0.45 uL equimolar mixture of Cy3 and Cy5 labeled CPK6 oligonucleotides (5'TTCCTCTCGCTGTAATGACCTCTATGAATAATCCTATCAAACAACTCA3' and 5'TTCCTCTCGCTGTAATGACCTCTATGAATAATCCTATCAAACAACTCA3', respectively) were added to prepare the hybridization mixture. The hybridization sample was heated to 95 °C and was applied to the slide and incubated in the MAUI® Hybridization Station (BioMicro Systems, Inc.) at 42 °C for 16-20 hours.
The hybridized slides from the MAUI® Hybridization Station were washed once in Wash 1 (0.2X SSC, 0.2% SDS, 0.1 mM DTT) for 10-15 seconds and followed by another wash in Wash 1 (0.2X SSC, 0.2% SDS, 0.1 mM DTT) for 2 minutes with gentle agitation. The slides were then washed in Wash 2 (0.2X SSC and 0.1mM DTT) for 1 minute and followed by a wash in Wash 3 (0.05X SSC and 0.1 mM DTT) for 15 seconds. The slides were dried by centrifugation
|
Scan protocol |
Measurement data and specifications: The hybridized arrays were scanned on an Axon GenePix 4000B scanner (Axon Instruments Inc.) at wavelengths of 532nm for control (Cy3), and 635nm (Cy5) for experimental sample. PCR arrays were processed using GenePix 4.0 software while NimbleGen data were extracted from the scanned images using the NimbleScan 2.0 program (NimbleGen Systems, Inc.). The arrays were gridded using the automated gridding algorithm, and extracted in two channels using a mean intensity calculation of the interior of the gridded rectangular features upon extraction, and each pair of N probe signals were converted into a scaled log ratio using the function: R(i) = Log (Experimental(i) / Control(i))
|
Description |
HeLa S3 cells (ATCC CCL-2.2) were cultured under adherent conditions in DMEM + 10% FBS. At 80% confluency, half of the cells were treated with 10 ng/mL interferon gamma (IFNγ, Sigma I-3265) and incubated for 30 min under normal cultur (37ºC, 5% CO2).
|
Data processing |
raw data
|
|
|
Submission date |
Nov 17, 2006 |
Last update date |
Nov 28, 2006 |
Contact name |
Bing Ren |
E-mail(s) |
biren@ucsd.edu
|
Organization name |
Ludwig Institute for Cancer Research
|
Department |
Department of Cellular and Molecular Medicine
|
Lab |
Laboratory of Gene Regulation
|
Street address |
9500 Gilman Drive
|
City |
La Jolla |
State/province |
CA |
ZIP/Postal code |
92093-0653 |
Country |
USA |
|
|
Platform ID |
GPL1454 |
Series (1) |
GSE6273 |
Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome |
|