 |
 |
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Apr 20, 2015 |
Title |
KO_DNA |
Sample type |
SRA |
|
|
Source name |
Haunt P-exon2 KO mES cells
|
Organism |
Mus musculus |
Characteristics |
cell line: 46C cell type: embryonic stem cells genotype/variation: Haunt P-exon2 KO treatment: none strain: 129/Ola chirp probes: ChIRP probes targeting Haunt mRNA
|
Treatment protocol |
Cells were washed once with cold PBS, then harvested by trypsin digestion.
|
Growth protocol |
Wild-type ESCs or Haunt KO ESCs were maintained in strandard ES medium supplemented with 15% heat-inactivated FCS, 1% of nucleoside mix (100 × stock, Millipore), Penicillin-Streptomycin Solution (100 × stock, Life Technologies), 2 mM Glutamax (100 × Life Technology), 0.1 mM non-essential amino acid, 0.1 mM 2-mercaptoethanol and supplied with 1000 U/ml recombinant leukemia inhibitory factor (LIF, millipore).
|
Extracted molecule |
genomic DNA |
Extraction protocol |
ChIRP was done as described previously with the following modifications (Chu et al. 2011). First, 59 nt DNA probes were biotinylated through terminal transferase (New England Biolabs). Intensive crosslinking of cells was performed in the following sequence: two rounds of 3000J UV treatment on ice, 0.8% of formaldehyde (FMA) for 10 minutes, 2mM of DSP (Dithiobis [succinimidyl propionate]) for 30 minutes, and followed by 3.7% of FMA for 10 minutes at room temperature. Crosslinked cell pellets were lysed. Chromatin was fragmented into a range of 2 - 5 kb by sonication. Hybridization, washing and elution steps were performed as described previously, except that we included an additional stringent wash (0.1x SSC). After elution and reverse crosslinking, then purified by MinElute PCR Purification Kit (QIAGEN). The library was constructed by library preparation modules (New England Biolabs) according to manufacturer's instructions. Briefly, ChIRP retrieved DNA was end repaired, and dA-tailed by respect module according to respect instruments. The DNA product then ligated with adaptor with NEBNext Quick Ligation Module. The adaptor for the libary were sythersized from IDT with the first 7nt is "CAGATGT" as a barcode. After liagation, the DNA were amplified by primer 1.0 (AATGATACGGCGACCACCGAGATCTACAC, synthersized from IDT) and 2.0 (CAAGCAGAAGACGGCATACGAGAT, synthersized from IDT) for 15 cycles. After this, the product was further purified and size selected by Ampure XP beads (Beckman Coulter). The library was sequenced on the Illumina instrument following the manufacturer's protocols.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
Sample 23 barcode: CAGATGT Sample 23
|
Data processing |
library strategy: ChIRP-seq The sequencing company provided "clean reads" (i.e., low quality reads removed). Basecalls performed using CASAVA version ChIRP retrived DNA-Seq reads were aligned to the mm9 genome assembly using Bowtie version 1.0.0 with the default parameters RNA-seq reads were aligned to the mm9 genome assembly using Tophat v2.0.11,allowing for uniquely mapped reads and mapping both spliced and unspliced reads. FPKM was calculated by Cufflink 2.1.1 Peaks of each sample were called using MACS v. 1.4.2 Genome_build: mm9 Supplementary_files_format_and_content: RNA-seq: tab-delimited text files include FPKM values for wild-type or Haunt KO Samples; ChIRP-seq: bedgraph files were generated using MACS v. 1.4.2, including peaks called by default parameters.
|
|
|
Submission date |
Jun 16, 2014 |
Last update date |
May 15, 2019 |
Contact name |
jinlong lu |
E-mail(s) |
bioyuyang@hotmail.com
|
Phone |
5853098469
|
Organization name |
University of Rochester
|
Lab |
Gorbunova & Seluanov Labs
|
Street address |
213 Hutchinson Hall
|
City |
Rochester |
State/province |
NY |
ZIP/Postal code |
14627 |
Country |
USA |
|
|
Platform ID |
GPL17021 |
Series (1) |
GSE58514 |
Opposing roles for the lncRNA Haunt and its genomic locus in regulating HOXA gene activation during embryonic stem cell differentiation |
|
Relations |
BioSample |
SAMN02863127 |
SRA |
SRX644391 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1412848_DNAKO.bedgraph.gz |
4.2 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
 |