NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1399555 Query DataSets for GSM1399555
Status Public on Jul 31, 2015
Title L3521_WT3_WK8
Sample type SRA
 
Source name WT_week8
Organism Mus musculus
Characteristics age: 8 weeks
genotype/variation: wild type
tissue: islets
Treatment protocol Maintained for two hours in RPMI-1640 supplemented with 10% FBS
Growth protocol Islets isolated from fresh pancreata
Extracted molecule total RNA
Extraction protocol Total RNA was prepared using the RNeasy kit (Qiagen) with on-column genomic DNA digestion.
mRNA was isolated from 1ug total RNA by poly-dT enrichment using the NEBNext Poly(A) mRNA Magnetic Isolation Module according to the manufacturers instructions. Final elution was done in 15ul 2x first strand cDNA synthesis buffer (NEBnext, NEB). After chemical fragmentation by incubating for 15 min at 94°C the sample was directly subjected to the workflow for strand specific RNA-Seq library preparation (Ultra Directional RNA Library Prep, NEB). For ligation custom adaptors were used (Adaptor-Oligo 1: 5'-ACA-CTC-TTT-CCC-TAC-ACG-ACG-CTC-TTC-CGA-TCT-3', Adaptor-Oligo 2: 5'-P-GAT-CGG-AAG-AGC-ACA-CGT-CTG-AAC-TCC-AGT-CAC-3'). After ligaton adapters were depleted by an XP bead purification (Beckman Coulter) adding bead in a ratio of 1:1. Indexing was done during the following PCR enrichment (15 cycles) using custom amplification primers carring the index sequence indicated with ‘NNNNNN’. (Primer1: Oligo_Seq AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, primer2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, primer3: CAAGCAGAAGACGGCATACGAGAT NNNNNN GTGACTGGAGTT. After two more XP beads purifications (1:1) libraries were quantified using Qubit dsDNA HS Assay Kit (Invitrogen). For Illumina flowcell production, samples were equimolarly pooled and distributed on all lanes used for 75bp single read sequencing on Illumina HiSeq 2500.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 2500
 
Data processing Alignment of the short reads to the mm9 transcriptome was performed with pBWA, version 0.5.9-r32-MPI-patch2 (Peters et al., 2011).
Counts per gene were computed based on the Ensembl Genes v.67 annotation for mouse using BEDtools (v. 2.11).
Normalization of the raw readcounts based on the library size and testing for differential expression between the different cell types/treatments was performed with the DESeq R package (v.1.10.1)
Genome_build: mm9
Supplementary_files_format_and_content: p363_PROCESSED_RNA-SEQ.xlsx contains genes being differentially expressed and the complete counts table for all samples. For analysis raw data fastq files for individual samples were merged.
 
Submission date May 28, 2014
Last update date May 15, 2019
Contact name Anthony Gavalas
Organization name TU Dresden
Street address Fetscherstr. 105
City Dresden
ZIP/Postal code 01307
Country Germany
 
Platform ID GPL17021
Series (1)
GSE58025 Aldehyde dehydrogenase activity is necessary for beta cell development and functionality in mice
Relations
BioSample SAMN02801752
SRA SRX554690

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap