 |
 |
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jul 15, 2013 |
Title |
polyA RNA sequencing of STL003 Left Ventricle Cells; polyA-RNA-seq_STL003LV_r1a |
Sample type |
SRA |
|
|
Source name |
Left Ventricle tissue; polyA-RNA-seq_STL003LV_r1a
|
Organism |
Homo sapiens |
Characteristics |
sample alias: STL003LV-01 sample common name: Left Ventricle disease: None biomaterial_provider: Shin Lin, Stanford University biomaterial_type: Primary Tissue tissue_type: Left Ventricle tissue_depot: N/A collection_method: Autopsy donor_id: STL003 donor_age: 34 donor_health_status: polysubstance abuse (NO diabetes, hypertension, coronary artery disease, cancer) donor_sex: Male donor_ethnicity: Caucasian experiment_type: mRNA-Seq extraction_protocol: Qiagen RNeasy mini kit, performed as per manufacturer's instructions cdna_preparation_initial_rna_qnty: 4 µg cdna_preparation_polya_rna/: Dynabeads oligo(dt)25 (Invitrogen) cdna_preparation_fragmentation: PolyA RNA resuspended in 2x Superscript III buffer supplemented with 10 mM DTT was incubated at 94°C for 4 min cdna_preparation_fragment_size_range: 200-250 cdna_preparation_first_strand_synthesis_enzyme: SuperScript III (Invitrogen) cdna_preparation_first_strand_purification: Purification with RNAClean XP beads (Agencourt) cdna_preparation_second_strand_synthesis_enzyme: DNA Polymerase I (E. coli) (New England Biolabs) cdna_preparation_second_strand_synthesis_dntp_mix: dNTP mix made from 10 mM dATP, dCTP, dGTP, dUTP cdna_preparation_purification: Purification with AMPure XP beads (Agencourt) dna_preparation_adaptor: TruSeq Multiplexed Adapters (Illumina) dna_preparation_adaptor_ligation_protocol: 16°C for 16 hours with T4 DNA ligase (New England Biolabs) dna_preparation_post-ligation_fragment_size_selection: Two rounds of purification with AMPure XP beads (Agencourt) dna_preparation_uracil_dna_glycosylase_digestion: One half of adapter-ligated cDNA digested with uracil DNA glycosylase (Enzymatics) and used for subsequent steps. library_generation_pcr_polymerase_type: TruSeq PCR Master Mix (Illumina) library_generation_pcr_thermocycling_program: 98°C 30 sec; 10 cycles of 98°C 10 sec, 60°C 30 sec, 72°C 30 sec; 72°C 10 min library_generation_pcr_number_cycles: 10 library_generation_pcr_primer: TruSeq PCR Primer Cocktail (Illumina) library_generation_pcr_product_isolation_protocol: Purification with AMPure XP beads (Agencourt) extraction_protocol_mrna_enrichment: Dynabeads oligo(dt)25 protocol rna_preparation_reverse_transcription_primer_sequence: Random hexamers rna_preparation_reverse_transcription_protocol: First-strand Superscript III (Invitrogen) RT protocol. RNAClean XP purification of first strand product. Second-strand synthesis using dUTP-containing dNTPS and DNA Polymerase 1 (E. coli) (New England Biolabs) library_generation_pcr_template: cDNA library_generation_pcr_template_conc: 5 ng/µL library_generation_pcr_f_primer_sequence: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC 3' library_generation_pcr_r_primer_sequence: 5' CAAGCAGAAGACGGCATACGAGAT 3' library_generation_pcr_primer_conc: 200nM
|
Extracted molecule |
total RNA |
Extraction protocol |
Library construction protocol: Four µg of total RNA was extracted from frozen cell pellets using the RNeasy Mini Kit (Qiagen, Valencia, CA). PolyA RNA was isolated from total RNA using Dynabeads oligo(dt)25 (Invitrogen). PolyA selected RNA was eluted in 2x Superscript III buffer supplemented with 10mM DTT and was fragmented by incubation at 94°C for 4 minutes. First-strand cDNA was synthesized with the following reaction composition: 0.5 µL random hexamer, 0.5 µL RNase Out, 1 µL DTT (100 mM), 0.5 µL dNTP (25 mM), 0.5 µL SuperScript III (20 µL final). The reaction was incubated at 25°C for 10 min then 50°C for 50 min. Single-stranded cDNA was isolated by purification with RNAClean XP beads (Beckman Coulter Genomics, Danvers, MA). The dUTP-containing second-strand was synthesized with the following reaction: 1.5 µL NEBuffer 2 (NEB), 1 µL dNTP mix (10 mM dATP, dCTP, dGTP, and dUTP), 0.2 µL RNase H, 1 µL DNA Polymerase I (E. coli) (New England Biolabs) (15 µL final). The reaction was incubated at 16°C for 2.5 hours. The dUTP-containing cDNA was isolated by purification with AMPure XP beads (Beckman Coulter Genomics, Danvers, MA). The dUTP-containing cDNA was then end repaired and a 3'A base was added. TruSeq adapters (Illumina, San Diego, CA) were ligated to the dUTP-containing cDNA at 16°C for 16 hours with T4 DNA ligase (New England Biolabs). Adapter-ligated cDNA was isolated by two rounds of purification with AMPure XP beads. The dUTP-containing strands were digested at 37°C for 30 min with uracil DNA glycosylase (Enzymatics). Adapter-ligated, single-stranded DNA molecules were enriched by 10 cycles of PCR with the following reaction composition: 5 µL TruSeq PCR Primer Cocktail (Illumina), 25 µL TruSeq PCR Master Mix (Illumina) (50 µL final). The thermocycling parameters were: 98°C 30 sec, then 10-15 cycles of 98°C 10 sec, 60°C 30 sec and 72°C 30 sec, ending with one 72°C 5 min step. The reaction products were purified using AMPure XP beads.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
sample_term_id: UBERON_0002084 assay_term_id: OBI_0001271 nucleic_acid_term_id: SO_0000871 Design description: polyA RNA sequencing of STL003 Left Ventricle Cells Library name: polyA-RNA-seq_STL003LV_r1a EDACC Genboree Experiment Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FEXPERIMENT%2FEDACC.13851 EDACC Genboree Sample Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FSAMPLE%2FEDACC.11885 **************** For data usage terms and conditions, please refer to: http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies ****************
|
Data processing |
**********************************************************************
ANALYSIS FILE NAME: GSM1010964_UCSD.Left_Ventricle.mRNA-Seq.STL003.bed ANALYSIS CENTER: EDACC ANALYSIS ALIAS: polyA-RNA-seq_STL003LV_r1a.hg19.level.1.release.9 ANALYSIS TITLE: Mapping of Left Ventricle mRNA-Seq Data ANALYSIS DESCRIPTION: Illumina reads produced by mRNA-Seq on Left Ventricle, Donor STL003 were mapped to the human genome using Pash. ANALYSIS TYPE: REFERENCE_ALIGNMENT EDACC Genboree Analysis Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FEDACC%2FANALYSIS%2FEDACC.16746 DATA_ANALYSIS_LEVEL: 1 EXPERIMENT_TYPE: mRNA-Seq GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 SOFTWARE: Pash SOFTWARE_VERSION: 3.0 MAXIMUM_ALIGNMENT_LENGTH: Read length MISMATCHES_ALLOWED: 10% of read length ALIGNMENTS_ALLOWED: 1 TREATMENT_OF_MULTIPLE_ALIGNMENTS: If a read maps to more than 1 position it is removed from consideration. TREATMENT_OF_IDENTICAL_ALIGNMENTS_OF_MULTIPLE_READS: None ALIGNMENT_POSTPROCESSING: None RELEASE_NUMBER: Human Epigenome Atlas 9
QUALITY SCORES: NUMBER_OF_MAPPED_READS: 170,860,436 PERCENT_READS_MAPPING_TO_UCSC_GENES: 93.31 PERCENT_READS_MAPPING_TO_UCSC_GENES_PERCENTILE: 50 MAXIMUM_REPLICATE_CORRELATION: 0.66
**********************************************************************
ANALYSIS FILE NAME: GSM1010964_UCSD.Left_Ventricle.mRNA-Seq.STL003.wig ANALYSIS CENTER: EDACC ANALYSIS ALIAS: polyA-RNA-seq_STL003LV_r1a.hg19.level.2.release.9 ANALYSIS TITLE: Raw Signal Density Graphs of Left Ventricle mRNA-Seq Data ANALYSIS DESCRIPTION: Illumina mRNA-Seq read mappings from Left Ventricle, Donor STL003 were processed into density graphs of raw signal representing the aligned read density. ANALYSIS TYPE: ABUNDANCE_MEASUREMENT EDACC Genboree Analysis Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FEDACC%2FANALYSIS%2FEDACC.16781 DATA_ANALYSIS_LEVEL: 2 EXPERIMENT_TYPE: mRNA-Seq GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 SOFTWARE: In house programs and scripts SOFTWARE_VERSION: NA READ_EXTENSION: 0bp GENOMIC_WINDOW: 20bp TREATMENT_OF_REGIONS_PRONE_TO_MULTIPLE_ALIGNMENTS: None RELEASE_NUMBER: Human Epigenome Atlas 9 BROWSER_TRACK_NAME: LV mRNA 03 BROWSER_TRACK_DESCRIPTION: UCSD Left Ventricle mRNA-Seq Donor STL003 Library polyA-RNA-seq_STL003LV_r1a EA Release 9
QUALITY SCORES: NUMBER_OF_MAPPED_READS: 170,860,436 PERCENT_READS_MAPPING_TO_UCSC_GENES: 93.31 PERCENT_READS_MAPPING_TO_UCSC_GENES_PERCENTILE: 50 MAXIMUM_REPLICATE_CORRELATION: 0.66
**********************************************************************
|
|
|
Submission date |
Sep 28, 2012 |
Last update date |
May 15, 2019 |
Contact name |
UCSD AND SALK |
Organization name |
University of California, San Diego
|
Street address |
Health Sciences Drive
|
City |
La Jolla |
State/province |
CA |
ZIP/Postal code |
92092 |
Country |
USA |
|
|
Platform ID |
GPL11154 |
Series (1) |
GSE16256 |
UCSD Human Reference Epigenome Mapping Project |
|
Relations |
Reanalyzed by |
GSE87112 |
Reanalyzed by |
GSE99453 |
SRA |
SRX190136 |
BioSample |
SAMN00847538 |
Named Annotation |
GSM1010964_UCSD.Left_Ventricle.mRNA-Seq.STL003.wig.gz |
Supplementary file |
Size |
Download |
File type/resource |
GSM1010964_UCSD.Left_Ventricle.mRNA-Seq.STL003.bed.gz |
1.8 Gb |
(ftp)(http) |
BED |
GSM1010964_UCSD.Left_Ventricle.mRNA-Seq.STL003.wig.gz |
22.9 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
Raw data not provided for this record |
Processed data provided as supplementary file |
Raw data are available in SRA |
|
|
|
|
 |