|
| Status |
Public on Jan 11, 2016 |
| Title |
Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq) |
| Organism |
Homo sapiens |
| Experiment type |
Expression profiling by high throughput sequencing
|
| Summary |
Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
|
| |
|
| Overall design |
Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
|
| |
|
| Contributor(s) |
Floor SN, Doudna JA |
| Citation(s) |
26735365 |
| |
| Submission date |
May 29, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Stephen N. Floor |
| E-mail(s) |
stephen.floor@ucsf.edu
|
| Organization name |
University of California, San Francisco
|
| Department |
Cell and Tissue Biology
|
| Lab |
Floor Lab
|
| Street address |
513 Parnassus Ave, HSW 740
|
| City |
San Francisco |
| State/province |
CA |
| ZIP/Postal code |
94143 |
| Country |
USA |
| |
|
| Platforms (1) |
| GPL16791 |
Illumina HiSeq 2500 (Homo sapiens) |
|
| Samples (18)
|
|
| Relations |
| BioProject |
PRJNA285284 |
| SRA |
SRP058841 |