NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Reviewer access | Sign OutHelp
GEO help: Mouse over screen elements for information.
          Go
Series GSE69352 Query DataSets for GSE69352
Status Public on Jan 11, 2016
Title Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)
Organism Homo sapiens
Experiment type Expression profiling by high throughput sequencing
Summary Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
 
Overall design Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
 
Contributor(s) Floor SN, Doudna JA
Citation(s) 26735365
Submission date May 29, 2015
Last update date May 15, 2019
Contact name Stephen N. Floor
E-mail(s) stephen.floor@ucsf.edu
Organization name University of California, San Francisco
Department Cell and Tissue Biology
Lab Floor Lab
Street address 513 Parnassus Ave, HSW 740
City San Francisco
State/province CA
ZIP/Postal code 94143
Country USA
 
Platforms (1)
GPL16791 Illumina HiSeq 2500 (Homo sapiens)
Samples (18)
GSM1698470 cyto_rep1
GSM1698471 80S_rep1
GSM1698472 poly2_rep1
Relations
BioProject PRJNA285284
SRA SRP058841

Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp
Series Matrix File(s) TXTHelp

Supplementary file Size Download File type/resource
GSE69352_tripseq_gene_tpm_ensembl_v75.csv.gz 2.2 Mb (ftp)(http) CSV
GSE69352_tripseq_isoform_tpm_ensembl_v75.csv.gz 7.4 Mb (ftp)(http) CSV
SRA Run SelectorHelp
Processed data are available on Series record
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap