|
Status |
Public on Nov 05, 2014 |
Title |
Single-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification |
Organism |
Mus musculus |
Experiment type |
Genome binding/occupancy profiling by high throughput sequencing
|
Summary |
The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), termed HA-T-VP64-PU.1-14, in the 416B mouse myeloid progenitor cell line.
|
|
|
Overall design |
Inducible T-VP64-PU.1-14 transgene contained within the piggyBac vector was stably integrated into 416B cells by transfection along with a constituteively expressed rtTA plasmid (pCAG-rtTA-piggyBac) and a piggyBac transposase. 416Bs carrying stably integrated transgenes were FACS sorted based on their ability to expressed the transgene and expanded before HA-T-VP64-PU.1-14 expression was induced for 48 hours by addition of dox before cells were fixed with 1% formaldehyde for 10 mins. Chromatin was isolated, sonicated for 7 mins (30 sec on, 30 sec off), and an anti-HA antibody used to pull down the HA-T-VP64-PU.1-14 after a pre-clearing step. Chromatin was washed, de-crosslinked, amplified, size selected by gel purification and sequenced. As a control, untransfected 416B cells were similarly ChIP'd.
|
|
|
Contributor(s) |
Wilkinson AC |
Citation(s) |
25252941 |
|
Submission date |
Sep 08, 2014 |
Last update date |
May 15, 2019 |
Contact name |
Bertie Gottgens |
E-mail(s) |
bg200@cam.ac.uk
|
Organization name |
University of Cambridge
|
Street address |
Jeffrey Cheah Biomedical Centre
|
City |
Cambridge |
ZIP/Postal code |
CB2 0AW |
Country |
United Kingdom |
|
|
Platforms (1) |
GPL17021 |
Illumina HiSeq 2500 (Mus musculus) |
|
Samples (2) |
|
Relations |
BioProject |
PRJNA260492 |
SRA |
SRP046309 |