NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL9458 Query DataSets for GPL9458
Status Public on Oct 31, 2009
Title Washington University/Genome Sequencing Center C. elegans 23K
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Caenorhabditis elegans
Manufacturer Genome Sequencing Center, Washington University in St. Louis
Manufacture protocol http://genomeold.wustl.edu/genome/celegans/microarray/array_spec.cgi
 
 
Submission date Oct 16, 2009
Last update date Apr 15, 2011
Contact name C Michael Crowder
E-mail(s) crowderm@morpheus.wustl.edu
Organization name Washington University in St. Louis
Department Anesthesiology
Street address 660 S. Euclid Ave Campus Box 8054
City St. Louis
State/province MO
ZIP/Postal code 63110
Country USA
 
Samples (175) GSM462494, GSM462495, GSM462496, GSM462497, GSM462498, GSM462499 
Series (8)
GSE18601 Divergent mechanisms controlling hypoxic sensitivity and lifespan by the DAF-2/Insulin/IGF-receptor pathway
GSE22383 Insulin-like Signaling Determines Survival During Stress via Post Transcriptional Mechanisms in C. elegans.
GSE28665 Lifespan extension via eIF4G inhibition is mediated by post-transcriptional remodeling of stress response gene expression in C. elegans

Data table header descriptions
ID
Array Row Position on the array
Array Column Position on the array
Spot Row Position on the array
Spot Column Position on the array
GenBank ID GenBank accession number of spotted sequence
cDNA name spotted oligo ID
ORF
SPOT_ID
SEQUENCE

Data table
ID Array Row Array Column Spot Row Spot Column GenBank ID cDNA name ORF SPOT_ID SEQUENCE
1 1 1 1 1 Spot Report 1 - Cab Spot Report 1 - Cab --Spot Report 1 - Cab tcgtttattatttgtcaccgggttccatcccccttacgtttgacaatcattgcactcact
2 1 1 1 2 C25A1.8 cea2.c.00914 C25A1.8 ctccatcccacacacacacacttgtccaaacccaatgtatatttctcggaatatccccga
3 1 1 1 3 F21F3.6 cea2.c.02677 F21F3.6 ggcgtccaatcggagaattcacaagagtgtcgaacgaagagctcgatcaagttatcacat
4 1 1 1 4 F25H2.9 cea2.c.02801 F25H2.9 tttcgtattctattcccacccctctcctgtttttattgattcatcctcgaagtgcgtgga
5 1 1 1 5 F56H1.4 cea2.c.04344 F56H1.4 tttggtgccttcattatggcgtttcgtacgccttttttgccaataaaccttctggtctct
6 1 1 1 6 H06O01.1 cea2.c.04508 H06O01.1 tcgccgagccagatgcagttgatggagatgagcaagacgacaaggagacataatttaaat
7 1 1 1 7 T20F10.2 cea2.c.06048 T20F10.2 ccacagaggcagagtagcagtggaggatgctgctagattcatgtttttccctcttacttc
8 1 1 1 8 T23H2.5 cea2.c.06316 T23H2.5 gttcccgccgttgccattcccctgacaaaaaatatggtcggcatttgtctgtacaaattg
9 1 1 1 9 Y65B4BR.6 cea2.c.07850 Y65B4BR.6 cctctttcccgtcaaactggtacttgccattccactgaaatgttccgattgttcaaacga
10 1 1 1 10 Y71F9B.8 cea2.c.08046 Y71F9B.8 cacgagaagcctctgtacacgcatataaccaatgcgacagacactcggaatattgatcgg
11 1 1 1 11 C16A11.1 cea2.c.10006 C16A11.1 tcattccctctctctcttgtttctctctgtctctcttcccttcccattgattcctttctt
12 1 1 1 12 C30B5.6 cea2.c.10341 C30B5.6 tgtttcccccttccaccaattccccccacgtcctaatgaaatgaaagcgagaagataaat
13 1 1 1 13 F33A8.2 cea2.c.11934 F33A8.2 gagacaaggccattccatactgtgaggctgctctcaaattgaagtacaagaaggccagta
14 1 1 1 14 F37H8.5 cea2.c.12152 F37H8.5 actgttttctcatccactacgttttgtgtctccctcctcctttctccagaacaactctgt
15 1 1 1 15 R07G3.1 cea2.c.13713 R07G3.1 cccatcatcgagaactctggcaattggcaatggtgatagctcaattctgttctgtcttcc
16 1 1 1 16 T01E8.4 cea2.c.13904 T01E8.4 tcccggagattcgcaagcatcttgaatcgagcccggataagggattctaatcattttctg
17 1 1 1 17 Y48E1B.10 cea2.c.15361 Y48E1B.10 caaccccagaagaagccgagcagatcaaggcgttgaaggagaaatacgcgaaattatatc
18 1 1 1 18 Y54G9A.7 cea2.c.15549 Y54G9A.7 ggcagtcaagtcgaacaagttgttcaagacaaacggattcgtcggagacaatcattgacc
19 1 1 1 19 C16A3.4 cea2.c.17394 C16A3.4 agcgattatcgagtatgagtcccaaggaaagcaagaaatcgggtcagtggttgaaaagct
20 1 1 1 20 C28H8.12 cea2.c.17578 C28H8.12 taatatgtctatgggatcctcgatgtggttttgcctggtgggtggagtgttcttcaatgg

Total number of rows: 23232

Table truncated, full table size 2391 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL9458_jan04celegans_gal.gal.gz 221.4 Kb (ftp)(http) GAL

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap