 |
 |
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Oct 31, 2009 |
Title |
Washington University/Genome Sequencing Center C. elegans 23K |
Technology type |
spotted oligonucleotide |
Distribution |
non-commercial |
Organism |
Caenorhabditis elegans |
Manufacturer |
Genome Sequencing Center, Washington University in St. Louis |
Manufacture protocol |
http://genomeold.wustl.edu/genome/celegans/microarray/array_spec.cgi
|
|
|
|
|
Submission date |
Oct 16, 2009 |
Last update date |
Apr 15, 2011 |
Contact name |
C Michael Crowder |
E-mail(s) |
crowderm@morpheus.wustl.edu
|
Organization name |
Washington University in St. Louis
|
Department |
Anesthesiology
|
Street address |
660 S. Euclid Ave Campus Box 8054
|
City |
St. Louis |
State/province |
MO |
ZIP/Postal code |
63110 |
Country |
USA |
|
|
Samples (175)
|
GSM462494, GSM462495, GSM462496, GSM462497, GSM462498, GSM462499
GSM462500, GSM462501, GSM462502, GSM462503, GSM462504, GSM462505, GSM462506, GSM462507, GSM462508, GSM462509, GSM462510, GSM462511, GSM556790, GSM556791, GSM556792, GSM556793, GSM556794, GSM556795, GSM556796, GSM556797, GSM556798, GSM556799, GSM556800, GSM556801, GSM556802, GSM556803, GSM556804, GSM556805, GSM556806, GSM556807, GSM556808, GSM556809, GSM556810, GSM556811, GSM556812, GSM556813, GSM556814, GSM556815, GSM556816, GSM556817, GSM556818, GSM556819, GSM556820, GSM556821, GSM556822, GSM556823, GSM556824, GSM556825, GSM556826, GSM556827, GSM556828, GSM556829, GSM556830, GSM556831, GSM556832, GSM556833, GSM556834, GSM556835, GSM556836, GSM556837, GSM556838, GSM556839, GSM556840, GSM556841, GSM556842, GSM556843, GSM556844, GSM556847, GSM556849, GSM556852, GSM556854, GSM556855, GSM556856, GSM556857, GSM556858, GSM556859, GSM556860, GSM556861, GSM556862, GSM556863, GSM556864, GSM556865, GSM556866, GSM556867, GSM710171, GSM710172, GSM710173, GSM710174, GSM710175, GSM710176, GSM710177, GSM710178, GSM710179, GSM710180, GSM710181, GSM710182, GSM742037, GSM742038, GSM742039, GSM742040, GSM742041, GSM742042, GSM742043, GSM742044, GSM856180, GSM856181, GSM856182, GSM856183, GSM856184, GSM856185, GSM856186, GSM856187, GSM856188, GSM971322, GSM971323, GSM971324, GSM971325, GSM971326, GSM971327, GSM971328, GSM971329, GSM971330, GSM1558423, GSM1558424, GSM1558425, GSM1558426, GSM1558427, GSM1558428, GSM1558429, GSM1558430, GSM1558431, GSM1558432, GSM1558433, GSM1558434, GSM1558435, GSM1558436, GSM2186968, GSM2186969, GSM2186970, GSM2186971, GSM2186972, GSM2186973, GSM2186974, GSM2186975, GSM2186976, GSM2186977, GSM2186978, GSM2186979, GSM2186980, GSM2186981, GSM2186982, GSM2186983, GSM2186984, GSM2186985, GSM2186986, GSM2186987, GSM2186988, GSM2186989, GSM2186990, GSM2186991, GSM2186992, GSM2186993, GSM2186994, GSM2186995, GSM2186996, GSM2186997, GSM2186998, GSM2186999, GSM2187000
|
Series (8)
|
GSE18601 |
Divergent mechanisms controlling hypoxic sensitivity and lifespan by the DAF-2/Insulin/IGF-receptor pathway |
GSE22383 |
Insulin-like Signaling Determines Survival During Stress via Post Transcriptional Mechanisms in C. elegans. |
GSE28665 |
Lifespan extension via eIF4G inhibition is mediated by post-transcriptional remodeling of stress response gene expression in C. elegans |
GSE29979 |
Radiation-Induced Genomic Instability in Caenorhabditis Elegans |
GSE34856 |
C. elegans: wildtype vs nhr-49-/-; wildtype vs nhr-66-/-; wildtype vs nhr-80-/- |
GSE39536 |
C.elegans exposed to P. aeurigonsa: Colonized vs Non colonized animals |
GSE63846 |
C.elegans treated with control or elt-2 RNAi during adulthood and exposed to E. coli or P. aeruginosa |
GSE82238 |
Assessing age-dependent effects of vhp-1 knock-down on gene expression |
|
Data table header descriptions |
ID |
|
Array Row |
Position on the array |
Array Column |
Position on the array |
Spot Row |
Position on the array |
Spot Column |
Position on the array |
GenBank ID |
GenBank accession number of spotted sequence |
cDNA name |
spotted oligo ID |
ORF |
|
SPOT_ID |
|
SEQUENCE |
|
Data table |
ID |
Array Row |
Array Column |
Spot Row |
Spot Column |
GenBank ID |
cDNA name |
ORF |
SPOT_ID |
SEQUENCE |
1 |
1 |
1 |
1 |
1 |
Spot Report 1 - Cab |
Spot Report 1 - Cab |
|
--Spot Report 1 - Cab |
tcgtttattatttgtcaccgggttccatcccccttacgtttgacaatcattgcactcact |
2 |
1 |
1 |
1 |
2 |
C25A1.8 |
cea2.c.00914 |
C25A1.8 |
|
ctccatcccacacacacacacttgtccaaacccaatgtatatttctcggaatatccccga |
3 |
1 |
1 |
1 |
3 |
F21F3.6 |
cea2.c.02677 |
F21F3.6 |
|
ggcgtccaatcggagaattcacaagagtgtcgaacgaagagctcgatcaagttatcacat |
4 |
1 |
1 |
1 |
4 |
F25H2.9 |
cea2.c.02801 |
F25H2.9 |
|
tttcgtattctattcccacccctctcctgtttttattgattcatcctcgaagtgcgtgga |
5 |
1 |
1 |
1 |
5 |
F56H1.4 |
cea2.c.04344 |
F56H1.4 |
|
tttggtgccttcattatggcgtttcgtacgccttttttgccaataaaccttctggtctct |
6 |
1 |
1 |
1 |
6 |
H06O01.1 |
cea2.c.04508 |
H06O01.1 |
|
tcgccgagccagatgcagttgatggagatgagcaagacgacaaggagacataatttaaat |
7 |
1 |
1 |
1 |
7 |
T20F10.2 |
cea2.c.06048 |
T20F10.2 |
|
ccacagaggcagagtagcagtggaggatgctgctagattcatgtttttccctcttacttc |
8 |
1 |
1 |
1 |
8 |
T23H2.5 |
cea2.c.06316 |
T23H2.5 |
|
gttcccgccgttgccattcccctgacaaaaaatatggtcggcatttgtctgtacaaattg |
9 |
1 |
1 |
1 |
9 |
Y65B4BR.6 |
cea2.c.07850 |
Y65B4BR.6 |
|
cctctttcccgtcaaactggtacttgccattccactgaaatgttccgattgttcaaacga |
10 |
1 |
1 |
1 |
10 |
Y71F9B.8 |
cea2.c.08046 |
Y71F9B.8 |
|
cacgagaagcctctgtacacgcatataaccaatgcgacagacactcggaatattgatcgg |
11 |
1 |
1 |
1 |
11 |
C16A11.1 |
cea2.c.10006 |
C16A11.1 |
|
tcattccctctctctcttgtttctctctgtctctcttcccttcccattgattcctttctt |
12 |
1 |
1 |
1 |
12 |
C30B5.6 |
cea2.c.10341 |
C30B5.6 |
|
tgtttcccccttccaccaattccccccacgtcctaatgaaatgaaagcgagaagataaat |
13 |
1 |
1 |
1 |
13 |
F33A8.2 |
cea2.c.11934 |
F33A8.2 |
|
gagacaaggccattccatactgtgaggctgctctcaaattgaagtacaagaaggccagta |
14 |
1 |
1 |
1 |
14 |
F37H8.5 |
cea2.c.12152 |
F37H8.5 |
|
actgttttctcatccactacgttttgtgtctccctcctcctttctccagaacaactctgt |
15 |
1 |
1 |
1 |
15 |
R07G3.1 |
cea2.c.13713 |
R07G3.1 |
|
cccatcatcgagaactctggcaattggcaatggtgatagctcaattctgttctgtcttcc |
16 |
1 |
1 |
1 |
16 |
T01E8.4 |
cea2.c.13904 |
T01E8.4 |
|
tcccggagattcgcaagcatcttgaatcgagcccggataagggattctaatcattttctg |
17 |
1 |
1 |
1 |
17 |
Y48E1B.10 |
cea2.c.15361 |
Y48E1B.10 |
|
caaccccagaagaagccgagcagatcaaggcgttgaaggagaaatacgcgaaattatatc |
18 |
1 |
1 |
1 |
18 |
Y54G9A.7 |
cea2.c.15549 |
Y54G9A.7 |
|
ggcagtcaagtcgaacaagttgttcaagacaaacggattcgtcggagacaatcattgacc |
19 |
1 |
1 |
1 |
19 |
C16A3.4 |
cea2.c.17394 |
C16A3.4 |
|
agcgattatcgagtatgagtcccaaggaaagcaagaaatcgggtcagtggttgaaaagct |
20 |
1 |
1 |
1 |
20 |
C28H8.12 |
cea2.c.17578 |
C28H8.12 |
|
taatatgtctatgggatcctcgatgtggttttgcctggtgggtggagtgttcttcaatgg |
Total number of rows: 23232
Table truncated, full table size 2391 Kbytes.
Supplementary file |
Size |
Download |
File type/resource |
GPL9458_jan04celegans_gal.gal.gz |
221.4 Kb |
(ftp)(http) |
GAL |
|
|
|
|
 |