NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL7202 Query DataSets for GPL7202
Status Public on Aug 22, 2008
Title Agilent-014868 Whole Mouse Genome Microarray 4x44K G4122F (Probe Name version)
Technology type in situ oligonucleotide
Distribution commercial
Organism Mus musculus
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
Catalog number G4122F
 
Description
Designed to truly represent all known genes in the mouse genome and their resulting transcripts, Agilent's Whole Mouse Genome Oligo – 4X44K microarray is comprised of 41,534 60-mer oligonucleotide probes representing over 41,000 mouse genes and transcripts. Content for this microarray was generated from leading public databases, including RefSeq, RIKEN, NIA, Ensembl, RIKEN, UCSC Goldenpath, and Unigene.

*** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL4134.
 
Submission date Aug 22, 2008
Last update date Jan 12, 2017
Organization Agilent Technologies
E-mail cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (9882) GSM315377, GSM315378, GSM315379, GSM315380, GSM330311, GSM330312 
Series (586)
GSE12541 Aldehyde oxidase homologue 2 (Aoh2) knockout mouse and retinoic acid synthesis
GSE13163 Gene expression in the pancreatic lymph node of Deaf1 knock out mice vs. BALB/c controls
GSE13358 Mouse ES cells' gene expression difference compared with that of the MEF cells
Relations
Alternative to GPL4134

Data table header descriptions
ID Agilent feature number
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeq Accession number
GB_ACC GenBank Accession number
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence

Data table
ID SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
A_51_P100021 A_51_P100021 FALSE AY454345 16656 Hivep3 human immunodeficiency virus type I enhancer binding protein 3 Mm.302758 gb|AY454345|tc|TC1584815|nap|NAP057482-1 chr4:119807944-119808005 mm|4qD2.1 Mus musculus clone pZAS3 328-2275 zinc finger protein ZAS3 (Krc) mRNA, partial cds; alternatively spliced. [AY454345] GO:0003676(nucleic acid binding)|GO:0003677(DNA binding)|GO:0005622(intracellular)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0008270(zinc ion binding)|GO:0045893(positive regulation of transcription, DNA-dependent)|GO:0046872(metal ion binding) CATGGCTGGATTAACGTATGTGTGTGGTATATAGATACACAGAGAGAAACCAAAGTGGTG
A_51_P100034 A_51_P100034 FALSE NM_027162 NM_027162 69674 Mif4gd MIF4G domain containing Mm.390387 ref|NM_027162|ref|NM_001243586|ref|NM_001243587|ref|NM_001243584 chr11:115469328-115469269 mm|11qE2 Mus musculus MIF4G domain containing (Mif4gd), transcript variant 1, mRNA [NM_027162] GO:0005488(binding)|GO:0005575(cellular_component)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0006417(regulation of translation)|GO:0008022(protein C-terminus binding)|GO:0016070(RNA metabolic process) GAGACTTTTGTGGAGGAAGCCTGTTTCCTCCAGTCATGAGTGACTGCCTCACCAGGTTGG
A_51_P100052 A_51_P100052 FALSE NM_198863 NM_198863 245450 Slitrk2 SLIT and NTRK-like family, member 2 Mm.336081 ENSMUST00000036043 ref|NM_198863|ref|NM_001161431|ens|ENSMUST00000036043|ens|ENSMUST00000166241 chrX:63908145-63908204 mm|XqA7.1 Mus musculus SLIT and NTRK-like family, member 2 (Slitrk2), transcript variant 2, mRNA [NM_198863] GO:0003674(molecular_function)|GO:0007409(axonogenesis)|GO:0016020(membrane)|GO:0016021(integral to membrane) CTAAATGTGAATTGCCAAGAAAGGAAGTTCACTAACATCTCTGACCTACAGCCCAAACCT
A_51_P100063 A_51_P100063 FALSE NM_010727 NM_010727 16924 Lnx1 ligand of numb-protein X 1 Mm.440403 ref|NM_010727|ref|NM_001159577|ref|NM_001159579|ref|NM_001159580 chr5:74993810-74993386 mm|5qC3.3 Mus musculus ligand of numb-protein X 1 (Lnx1), transcript variant 2, mRNA [NM_010727] GO:0004842(ubiquitin-protein ligase activity)|GO:0005515(protein binding)|GO:0005737(cytoplasm)|GO:0006511(ubiquitin-dependent protein catabolic process)|GO:0008270(zinc ion binding)|GO:0016874(ligase activity)|GO:0030165(PDZ domain binding)|GO:0042787(protein ubiquitination involved in ubiquitin-dependent protein catabolic process)|GO:0046872(metal ion binding)|GO:0051260(protein homooligomerization) GAAGAATCAGATGTGGTGACATTCTTCTCGCTGTCAACGGTAGAAGTACATCGGGTATGA
A_51_P100084 A_51_P100084 FALSE nap|NAP091803-1 unmapped AAGTCATCTCTCATGCCTATCAGAATACTCTGCCTCTAAGCCCAAATCAACATCTTAAAA
A_51_P100099 A_51_P100099 FALSE AK011292 69886 2610002J23Rik RIKEN cDNA 2610002J23 gene Mm.391799 gb|AK011292|tc|TC1611660|tc|TC1626427|riken|2610002J23 chr11:100318948-100318889 mm|11qD Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610002J23 product:unclassifiable, full insert sequence. [AK011292] TTTTGTTGTTTTACTTACAGCATATGTTCTGGTGATTGAAAACCAAACAGTTATGGAGGG
A_51_P100155 A_51_P100155 FALSE NM_027371 NM_027371 70285 Rpf1 ribosome production factor 1 homolog (S. cerevisiae) Mm.28128 ENSMUST00000029838 ref|NM_027371|ens|ENSMUST00000029838|gb|AK010079|gb|AK171079 chr3:146170053-146169498 mm|3qH2 Mus musculus ribosome production factor 1 homolog (S. cerevisiae) (Rpf1), transcript variant 2, mRNA [NM_027371] GO:0003723(RNA binding)|GO:0005634(nucleus)|GO:0005730(nucleolus)|GO:0006364(rRNA processing)|GO:0008150(biological_process)|GO:0019843(rRNA binding)|GO:0042254(ribosome biogenesis) TACGAAGGGGTCCACAAGCCACGGGAAATGGATACAAGTCGAAGGAAATTCCACTTATAA
A_51_P100174 A_51_P100174 FALSE NM_008613 NM_008613 17427 Mns1 meiosis-specific nuclear structural protein 1 Mm.387671 ENSMUST00000034746 ref|NM_008613|ens|ENSMUST00000034746|gb|D14849|gb|AK132772 chr9:72306274-72306333 mm|9qD Mus musculus meiosis-specific nuclear structural protein 1 (Mns1), mRNA [NM_008613] GO:0003674(molecular_function)|GO:0005634(nucleus)|GO:0005635(nuclear envelope)|GO:0005882(intermediate filament)|GO:0007126(meiosis)|GO:0008150(biological_process) CTGTTTTACAGTTGGTGACAGTAGGCCCTGGTCTATCTGCATGTTCTAAAACATCCTCCT
A_51_P100181 A_51_P100181 FALSE NM_001048208 NM_001048208 26896 Med14 mediator complex subunit 14 Mm.17616 ENSMUST00000096495 ref|NM_001048208|ens|ENSMUST00000096495|gb|AK136576|riken|9130409M07 chrX:12253601-12253542 mm|XqA1.1 Mus musculus mediator complex subunit 14 (Med14), transcript variant 1, mRNA [NM_001048208] GO:0001104(RNA polymerase II transcription cofactor activity)|GO:0003712(transcription cofactor activity)|GO:0003713(transcription coactivator activity)|GO:0004872(receptor activity)|GO:0005634(nucleus)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006357(regulation of transcription from RNA polymerase II promoter)|GO:0006367(transcription initiation from RNA polymerase II promoter)|GO:0016592(mediator complex)|GO:0030518(intracellular steroid hormone receptor signaling pathway)|GO:0030521(androgen receptor signaling pathway)|GO:0045893(positive regulation of transcription, DNA-dependent)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0046966(thyroid hormone receptor binding) CATCTCAATAGGATTTCTTTTTAAGAGTACTGTACTGTCTCTTGAAGCCAGTCAGGGACT
A_51_P100218 A_51_P100218 FALSE NM_134198 NM_134198 171232 Vmn1r234 vomeronasal 1 receptor 234 Mm.377189 ENSMUST00000079633 ref|NM_134198|ens|ENSMUST00000079633|gb|BC127026|tc|NP496264 chr17:21366635-21366694 mm|17qA3.2 Mus musculus vomeronasal 1 receptor 234 (Vmn1r234), mRNA [NM_134198] GO:0004872(receptor activity)|GO:0005550(pheromone binding)|GO:0005887(integral to plasma membrane)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0016503(pheromone receptor activity)|GO:0019236(response to pheromone) TTTAGTTAATCTTACCTGGCATCTAGTGAGTATCCATGCAATATTCTCAATGTGTTTTGC
A_51_P100227 A_51_P100227 FALSE NM_023579 NM_023579 70572 Ipo5 importin 5 Mm.221452 ENSMUST00000032898 ref|NM_023579|ens|ENSMUST00000032898|ens|ENSMUST00000164092|gb|AK079134 chr14:121346888-121346947 mm|14qE5 Mus musculus importin 5 (Ipo5), mRNA [NM_023579] GO:0005488(binding)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0006610(ribosomal protein import into nucleus)|GO:0006810(transport)|GO:0006886(intracellular protein transport)|GO:0008565(protein transporter activity)|GO:0015031(protein transport) GATCCAAACGTTTTGGCTTAGGATTTCCATTGCAGATTGTAATTGCTTTAGAGACACACG
A_51_P100238 A_51_P100238 FALSE NM_146376 NM_146376 258373 Olfr323 olfactory receptor 323 Mm.377463 ENSMUST00000070804 ref|NM_146376|ens|ENSMUST00000070804|gb|BC146611|tc|TC1599732 chr11:58438789-58438730 mm|11qB1.3 Mus musculus olfactory receptor 323 (Olfr323), mRNA [NM_146376] GO:0004871(signal transducer activity)|GO:0004872(receptor activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004984(olfactory receptor activity)|GO:0007165(signal transduction)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0007608(sensory perception of smell)|GO:0016021(integral to membrane) GGACCATGATCTCCATGTATGTGCGCCCAAATGCACATCTGTCACCGGAACTCAACAAGG
A_51_P100246 A_51_P100246 FALSE NM_145578 NM_145578 22192 Ube2m ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) Mm.196580 ENSMUST00000131837 ref|NM_145578|ref|NM_001168469|ref|NM_001243968|ens|ENSMUST00000131837 chr7:13621239-13621093 mm|7qA1 Mus musculus ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) (Ube2m), transcript variant 1, mRNA [NM_145578] GO:0000166(nucleotide binding)|GO:0004842(ubiquitin-protein ligase activity)|GO:0005524(ATP binding)|GO:0006464(protein modification process)|GO:0008152(metabolic process)|GO:0016567(protein ubiquitination)|GO:0016874(ligase activity)|GO:0016881(acid-amino acid ligase activity)|GO:0018169(ribosomal S6-glutamic acid ligase activity)|GO:0019788(NEDD8 ligase activity)|GO:0043525(positive regulation of neuron apoptosis)|GO:0045116(protein neddylation) AGTCCTTACGATAAACTCCATAATTTATGGCCTGCAGTATCTCTTCTTGGAGCCGAACCC
A_51_P100289 A_51_P100289 FALSE NM_020493 NM_020493 20807 Srf serum response factor Mm.45044 ENSMUST00000015749 ref|NM_020493|ens|ENSMUST00000015749|tc|TC1577357|tc|TC1718111 chr17:46683795-46683788 mm|17qC Mus musculus serum response factor (Srf), mRNA [NM_020493] GO:0000790(nuclear chromatin)|GO:0001076(RNA polymerase II transcription factor binding transcription factor activity)|GO:0001077(RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription)|GO:0001569(patterning of blood vessels)|GO:0001701(in utero embryonic development)|GO:0001707(mesoderm formation)|GO:0001764(neuron migration)|GO:0001829(trophectodermal cell differentiation)|GO:0001947(heart looping)|GO:0002011(morphogenesis of an epithelial sheet)|GO:0002042(cell migration involved in sprouting angiogenesis)|GO:0002521(leukocyte differentiation)|GO:0003677(DNA binding)|GO:0003682(chromatin binding)|GO:0003700(sequence-specific DNA binding transcription factor activity)|GO:0003705(sequence-specific distal enhancer binding RNA polymerase II transcription factor activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0005783(endoplasmic reticulum)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006366(transcription from RNA polymerase II promoter)|GO:0007015(actin filament organization)|GO:0007160(cell-matrix adhesion)|GO:0007275(multicellular organismal development)|GO:0007369(gastrulation)|GO:0007507(heart development)|GO:0007616(long-term memory)|GO:0008134(transcription factor binding)|GO:0008285(negative regulation of cell proliferation)|GO:0008306(associative learning)|GO:0009725(response to hormone stimulus)|GO:0010669(epithelial structure maintenance)|GO:0010735(positive regulation of transcription via serum response element binding)|GO:0010736(serum response element binding)|GO:0016337(cell-cell adhesion)|GO:0021766(hippocampus development)|GO:0022028(tangential migration from the subventricular zone to the olfactory bulb)|GO:0030036(actin cytoskeleton organization)|GO:0030038(contractile actin filament bundle assembly)|GO:0030155(regulation of cell adhesion)|GO:0030168(platelet activation)|GO:0030220(platelet formation)|GO:0030336(negative regulation of cell migration)|GO:0031175(neuron projection development)|GO:0031490(chromatin DNA binding)|GO:0033561(regulation of water loss via skin)|GO:0034097(response to cytokine stimulus)|GO:0035855(megakaryocyte development)|GO:0035912(dorsal aorta morphogenesis)|GO:0042803(protein homodimerization activity)|GO:0043149(stress fiber assembly)|GO:0043565(sequence-specific DNA binding)|GO:0043589(skin morphogenesis)|GO:0045059(positive thymic T cell selection)|GO:0045214(sarcomere organization)|GO:0045597(positive regulation of cell differentiation)|GO:0045893(positive regulation of transcription, DNA-dependent)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0045987(positive regulation of smooth muscle contraction)|GO:0046016(positive regulation of transcription by glucose)|GO:0046716(muscle cell homeostasis)|GO:0046983(protein dimerization activity)|GO:0048589(developmental growth)|GO:0048821(erythrocyte development)|GO:0051491(positive regulation of filopodium assembly)|GO:0055003(cardiac myofibril assembly)|GO:0060218(hemopoietic stem cell differentiation) GGTGTATCCCTAATTAAGTGCCTCTAGGGGTGTGTGCGCGCGCCTGTGTCCTGAGTGAAT
A_51_P100298 A_51_P100298 FALSE NM_152220 NM_152220 20908 Stx3 syntaxin 3 Mm.272264 ENSMUST00000112965 ref|NM_152220|ens|ENSMUST00000112965|ens|ENSMUST00000069285|gb|AK170105 chr19:11859903-11857591 mm|19qA Mus musculus syntaxin 3 (Stx3), transcript variant A, mRNA [NM_152220] GO:0001950(plasma membrane enriched fraction)|GO:0005484(SNAP receptor activity)|GO:0005515(protein binding)|GO:0005886(plasma membrane)|GO:0005911(cell-cell junction)|GO:0006810(transport)|GO:0006836(neurotransmitter transport)|GO:0006886(intracellular protein transport)|GO:0006887(exocytosis)|GO:0006944(cellular membrane fusion)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016192(vesicle-mediated transport)|GO:0016324(apical plasma membrane)|GO:0030426(growth cone)|GO:0031175(neuron projection development)|GO:0031201(SNARE complex)|GO:0034599(cellular response to oxidative stress)|GO:0042581(specific granule)|GO:0042582(azurophil granule)|GO:0043005(neuron projection)|GO:0050544(arachidonic acid binding) ATCGCCATGCTGGTGGAAAATCAGGGGGAGATGTTAGATAACATAGAGTTGAATGTCATG
A_51_P100309 A_51_P100309 FALSE NM_001039652 NM_001039652 18390 Oprm1 opioid receptor, mu 1 Mm.457998 ENSMUST00000092734 ref|NM_001039652|ens|ENSMUST00000092734|ens|ENSMUST00000056385|ens|ENSMUST00000150374 chr10:3516213-3516154 mm|10qA1 Mus musculus opioid receptor, mu 1 (Oprm1), mRNA [NM_001039652] GO:0004871(signal transducer activity)|GO:0004872(receptor activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004979(beta-endorphin receptor activity)|GO:0004985(opioid receptor activity)|GO:0005624(membrane fraction)|GO:0005886(plasma membrane)|GO:0005925(focal adhesion)|GO:0007165(signal transduction)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0007191(activation of adenylate cyclase activity by dopamine receptor signaling pathway)|GO:0007193(inhibition of adenylate cyclase activity by G-protein signaling pathway)|GO:0007218(neuropeptide signaling pathway)|GO:0007268(synaptic transmission)|GO:0007610(behavior)|GO:0007626(locomotory behavior)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0030425(dendrite)|GO:0031635(inhibition of adenylate cyclase activity by opioid receptor signaling pathway)|GO:0031681(G-protein beta-subunit binding)|GO:0032100(positive regulation of appetite)|GO:0032590(dendrite membrane)|GO:0032839(dendrite cytoplasm)|GO:0038003(opioid receptor signaling pathway)|GO:0038047(morphine receptor activity)|GO:0042383(sarcolemma)|GO:0043204(perikaryon)|GO:0044424(intracellular part)|GO:0045121(membrane raft)|GO:0051930(regulation of sensory perception of pain)|GO:0060079(regulation of excitatory postsynaptic membrane potential) GCCTGAACCCAGTTCTTTATGCGTTCCTGGATGAAAACTTCAAACGATGTTTTAGAGAGT
A_51_P100327 A_51_P100327 FALSE NM_013683 NM_013683 21354 Tap1 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) Mm.482076 ENSMUST00000166582 ref|NM_013683|ref|NM_001161730|ens|ENSMUST00000166582|ens|ENSMUST00000041633 chr17:34330854-34330913 mm|17qB1 Mus musculus transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (Tap1), transcript variant 1, mRNA [NM_013683] GO:0000166(nucleotide binding)|GO:0001916(positive regulation of T cell mediated cytotoxicity)|GO:0005215(transporter activity)|GO:0005524(ATP binding)|GO:0005739(mitochondrion)|GO:0005783(endoplasmic reticulum)|GO:0005792(microsome)|GO:0005886(plasma membrane)|GO:0006200(ATP catabolic process)|GO:0006810(transport)|GO:0006952(defense response)|GO:0008152(metabolic process)|GO:0015031(protein transport)|GO:0015197(peptide transporter activity)|GO:0015421(oligopeptide-transporting ATPase activity)|GO:0015833(peptide transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016887(ATPase activity)|GO:0017111(nucleoside-triphosphatase activity)|GO:0019060(intracellular transport of viral proteins in host cell)|GO:0019885(antigen processing and presentation of endogenous peptide antigen via MHC class I)|GO:0030176(integral to endoplasmic reticulum membrane)|GO:0042270(protection from natural killer cell mediated cytotoxicity)|GO:0042288(MHC class I protein binding)|GO:0042605(peptide antigen binding)|GO:0042626(ATPase activity, coupled to transmembrane movement of substances)|GO:0042803(protein homodimerization activity)|GO:0042825(TAP complex)|GO:0043531(ADP binding)|GO:0046967(cytosol to ER transport)|GO:0046978(TAP1 binding)|GO:0046979(TAP2 binding)|GO:0046980(tapasin binding)|GO:0046982(protein heterodimerization activity)|GO:0055085(transmembrane transport) TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG
A_51_P100347 A_51_P100347 FALSE NM_001033341 NM_001033341 240476 Zfp407 zinc finger protein 407 Mm.329575 ENSMUST00000125763 ref|NM_001033341|gb|AK032536|ens|ENSMUST00000125763|tc|TC1605152 chr18:84731042-84730983 mm|18qE4 Mus musculus zinc finger protein 407 (Zfp407), mRNA [NM_001033341] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process) CAAATGAAACTCAGAGGATGTATATGAAACACTTTAGAACACAGATGAAAACAAACGCAC
A_51_P100379 A_51_P100379 FALSE NM_177596 NM_177596 210853 Zfp947 zinc finger protein 947 Mm.441622 ENSMUST00000080249 ref|NM_177596|ens|ENSMUST00000080249|gb|AK032784|gb|BC120908 chr17:22281966-22281907 mm|17qA3.3 Mus musculus zinc finger protein 947 (Zfp947), mRNA [NM_177596] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process)|GO:0046872(metal ion binding) CCTGGTTATTTATATTCAGAAAAAAGTGTCCACTGGAAAACTATGGCATGTGCTTTATTC
A_51_P100428 A_51_P100428 FALSE AK076663 Mm.444665 gb|AK076663|riken|4930408C10|nap|NAP088623-1 chr14:55610280-55610339 mm|14qC3 Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930408C10 product:myosin heavy chain, cardiac muscle, adult, full insert sequence. [AK076663] AGGAAAATGAAGAAAGGCGATACATGGGCTTTTCCAAATGAGCTTATACATGAATGAAGA

Total number of rows: 41282

Table truncated, full table size 28135 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap