NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL7016 Query DataSets for GPL7016
Status Public on Jul 24, 2008
Title Synechocystis sp. PCC 6803 oligo array
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Synechocystis sp. PCC 6803
Manufacturer Khodursky lab, Univ. of Minnesota, USA
Manufacture protocol 1. The 70-nt oligomers were designed using ArrayOligoSelector [http://arrayoligosel.sourceforge.net/] and were synthesized by Invitrogen Corp. (Carlsbad, CA).
2. The oligos were resuspended in 5µl of 3×SSC in 384-well microwell plates to a final concentration of 66.7 pmol/µl and spotted onto poly-L-lysine coated microscopic glass slides using a 16-tip OmniGrid Microarray printer (GeneMachines, San Carlos, CA) as described previously (Eisen 1999).
Support glass
Coating polysine
 
 
Contributor(s) Zhang Z, Pendse ND, Khodursky A
Submission date Jul 02, 2008
Last update date Jul 24, 2008
Contact name Zhigang Zhang
Organization name University of Minnesota
Department BioTechnology Institute
Street address 1479 Gortner Avenue, Suite 140
City St. Paul
State/province MN
ZIP/Postal code 55108
Country USA
 
Samples (27) GSM303159, GSM303160, GSM303161, GSM303162, GSM303163, GSM303164 
Series (1)
GSE11970 Gene expression patterns of sulfur starvation in Synechocystis sp. PCC 6803

Data table header descriptions
ID Unique ID for array probes
ORF ORF name
GENE SYMBOL Gene symbols
DESCRIPTION Gene description
SEQUENCE Designed 70-nt oligonucleotide array probe sequences

Data table
ID ORF GENE SYMBOL DESCRIPTION SEQUENCE
388 sll0005 - hypothetical protein CCATCAAACCAAAACGATCAAAGTTGTGCCTCAACCCGCCATCGCTCAACAGGAGGAAACTTGGCAGCAT
392 sll0016 mltA probable membrane-bound lytic transglycosylase A AGTCGTTTTATCCCCCGCAATAATCGTCTAATTTTCTTTAAGGAAACCTCCGCCAGCACCCCCGCCAAGG
396 sll0020 clpC ATP-dependent Clp protease ATPase subunit GGTTTGGGCTTTGACTTTGCCGATGACCAAGCGGAGTCTCAGTACAATCGCATTCGTTCCTTGGTGAATG
400 sll0024 - unknown protein CACCATTGTTAGCACCCTAGTCTTTGACGAATTGGGGTCTATGTTTTCTTACCGTCGGGATTTACGGGAA
404 sll0031 - hypothetical protein CAGTTGGCCGGGGGCACCAATTGCCACACTATCACCAAGTTAAGCTCCCAAGACTTTTCTGTTCACCAAT
408 sll0037 - hypothetical protein GTAGAAACCTGTTTCATTGGCATTAGCCATCCCCGCTTAGAAGAAGGGTTCCGTCGGGCGAGGTTATATC
484 sll0177 - hypothetical protein GGCGAGACCTGTCGGAAACGGAACGCCGTTTTTACTTCCGGGAGTTTATTCGTAGTATCCAATTGGAACG
488 sll0181 - unknown protein CCCAGATTTTTATTTTCCGAAGCTTGACTTCTGGGTTGAAGTTAAATGTGAGCCGCCTAATGATCGCTCT
492 sll0185 - hypothetical protein TTGTGGCTGTAGCGGTGGATGGGGAACAAACCCGTAATGTGCATATGAAGTTTACCCGAGAGACTCCTTC
496 sll0192 - hypothetical protein CCCTTTTACCCGGTTCCCGATCACCGGAAATGGAACGCAATTGGGCCTTGATTGTGGAAAGTTTAACCAG
500 sll0199 petE plastocyanin TCACTGAGCCCGGCACCTACACCTACTACTGTGAACCCCACCGGGGTGCTGGCATGGTAGGCAAAGTTGT
504 sll0207 rfbA glucose-1-phosphate thymidylyltransferase CGATCAAAGCAAAATCTCCGGTCGGGTAACCATTGGCCCCCACAGTCAAATTATCAACAGCGTCATCCGT
580 sll0321 - unknown protein AACTATTCTCCCAACGGAGGAAGTTGACCGGAGCCATCGAGATTATAGCGCCCATTACCATCAAGCCCAA
584 sll0328 - unknown protein CCAGAGTCTTGTTAGGGGATTCGTTAGGGATCTCATCGATGCAGTTAATGGGCAGGAAAGGGAGAAAAAA
588 sll0336 accD acetyl-CoA carboxylase beta subunit CTACATCAACCCTTTTATCCCATTTTGCCCCCCCTCAATGCTGACTCCAATCAGGTGAACCCAGAGTTAG
592 sll0355 - hypothetical protein ATCTCCAGGGTTTAAGCATTAATTGGAGTGGTTCCGCCCTCGGTAGTAGCGGGGAACTGTGGATGTTGTT
596 sll0361 - hypothetical protein ATATCGAGATACCACCTCAACGGAAGAAGTGCTGAACATGGCCGATGCCTTCGATGCCACCGCCACAAAA
600 sll0369 - unknown protein GCTAGTCGCTGGGTCTTTTTGCCCCTAACCCTGTCCATTGTTTCCCAAATTGTTTATTTCTCCGTGCAAA
676 sll0482 - unknown protein TGGATCTAGCGGTTAACCTCCCCAACTTACGGTCCCAGATTCAACTTTATAGCTATGCCTGCCCCAGGGT
680 sll0487 - hypothetical protein GACTCGGCTGGACTGGAATTTTTGGGCTTTTCCAACCCTGATTATTGGCAACTAGATCGCCTGTTAGGCA

Total number of rows: 3064

Table truncated, full table size 346 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap