NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6947 Query DataSets for GPL6947
Status Public on Jun 10, 2008
Title Illumina HumanHT-12 V3.0 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description The HumanHT-12 V3.0 Expression BeadChip features up-to-date content derived from the National Center for Biotechnology Information Reference Sequence (NCBI RefSeq) database (Build 36.2, Release 22).

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://www.ncbi.nlm.nih.gov/projects/geo/info/spreadsheet.html
 
Submission date Jun 10, 2008
Last update date Aug 16, 2018
Organization Illumina Inc.
E-mail(s) expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (25235) GSM365197, GSM365198, GSM365199, GSM365200, GSM365201, GSM365202 
Series (525)
GSE13015 Genomic Transcriptional Profiling Identifies a Blood Biomarker Signature for the Diagnosis of Septicemic Melioidosis
GSE15530 Genome-wide analysis of gene expression perturbed by reptin shRNA in MCF7 subjected to normoxic and hypoxic conditions
GSE16568 Gene expression analyses of mir-22 overexpression in ovarian clear cell cancer cell line
Relations
Alternative to GPL19915 (ILMN_GENE version)

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
nuID
Species
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Unigene_ID Unigene id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome build 36 version 3
Cytoband
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq
Obsolete_Probe_Id Identifier of probe id before bgx time
GB_ACC

Data table
ID nuID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Unigene_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Array_Address_Id Probe_Type Probe_Start SEQUENCE Chromosome Probe_Chr_Orientation Probe_Coordinates Cytoband Definition Ontology_Component Ontology_Process Ontology_Function Synonyms Obsolete_Probe_Id GB_ACC
ILMN_1725881 rp13_p1x6D80lNLk3c Homo sapiens RefSeq ILMN_44919 ILMN_44919 LOC23117 XM_933824.1 XM_933824.1 23117 89040007 XM_933824.1 LOC23117 XP_938917.1 1710221 I 122 GGCTCCTCTTTGGGCTCCTACTGGAATTTATCAGCCATCAGTGCATCTCT 16 - 21766363-21766363:21769901-21769949 16p12.2a PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 11 (LOC23117), mRNA. XM_933824.1
ILMN_1910180 NEX0oqCV8.er4HVfU4 Homo sapiens Unigene ILMN_127219 ILMN_127219 HS.575038 Hs.575038 Hs.575038 10437021 AK024680 5900364 S 1409 ACACCTTCAGGAGGGAAGCCCTTATTTCTGGGTTGAACTCCCCTTCCATG Homo sapiens cDNA: FLJ21027 fis, clone CAE07110 AK024680
ILMN_1804174 KyqQynMZxJcruyylEU Homo sapiens RefSeq ILMN_139282 ILMN_139282 FCGR2B XM_938851.1 XM_938851.1 2213 88952550 XM_938851.1 FCGR2B XP_943944.1 2480717 I 1643 TAGGGGCAATAGGCTATACGCTACAGCCTAGGTGTGTAGTAGGCCACACC 1q23.3b PREDICTED: Homo sapiens Fc fragment of IgG, low affinity IIb, receptor (CD32) (FCGR2B), mRNA. XM_938851.1
ILMN_1796063 xXl7eXuF7sbPEp.KFI Homo sapiens RefSeq ILMN_5006 ILMN_5006 TRIM44 NM_017583.3 NM_017583.3 54765 29029528 NM_017583.3 TRIM44 NP_060053.2 1300239 S 2901 CCTGCCTGTCTGCCTGTGACCTGTGTACGTATTACAGGCTTTAGGACCAG 11 + 35786070-35786119 11p13a Homo sapiens tripartite motif-containing 44 (TRIM44), mRNA. intracellular [goid 5622] [evidence IEA] zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA] MGC3490; MC7; HSA249128; DIPB MGC3490; MC7; HSA249128; DIPB NM_017583.3
ILMN_1811966 9ckqJrioiaej9_ajeQ Homo sapiens RefSeq ILMN_38756 ILMN_38756 LOC653895 XM_936379.1 XM_936379.1 653895 89033487 XM_936379.1 LOC653895 XP_941472.1 4480719 S 25 CTAGCAGGGAGCGGTGAGGGAGAGCGGCTGGATTTCTTGCGGGATCTGCA 10q11.23b PREDICTED: Homo sapiens similar to protein geranylgeranyltransferase type I, beta subunit (LOC653895), mRNA. XM_936379.1
ILMN_1668162 rtCnUep15THUpc_0e4 Homo sapiens RefSeq ILMN_7652 ILMN_7652 DGAT2L3 NM_001013579.1 NM_001013579.1 158833 61888901 NM_001013579.1 DGAT2L3 NP_001013597.1 6020725 S 782 GTCAAGGCTCCACTGGGCTCCTGCCATACTCCAGGCCTATTGTCACTGTG X + 63280932-63280981 Xq13.1b Homo sapiens diacylglycerol O-acyltransferase 2-like 3 (DGAT2L3), mRNA. membrane [goid 16020] [evidence IEA]; integral to membrane [goid 16021] [evidence IEA]; endoplasmic reticulum [goid 5783] [evidence IEA] lipid biosynthesis [goid 8610] [evidence IEA]; lipid metabolism [goid 6629] [evidence IEA] acyltransferase activity [goid 8415] [evidence IEA]; transferase activity [goid 16740] [evidence IEA] AWAT1; DGA2 AWAT1; DGA2 NM_001013579.1
ILMN_1715600 QtVBXBWhekTEIT0kjo Homo sapiens RefSeq ILMN_35097 ILMN_35097 LOC387701 XM_373469.3 XM_373469.3 387701 89031576 XM_373469.3 LOC387701 XP_373469.1 3870215 A 301 GTCCCCAACCCTAACCCGGACCTGGCACATACAAGACATTCAGCAGATGG 10 + 92811754-92811767:92811768-92811803 PREDICTED: Homo sapiens hypothetical LOC387701 (LOC387701), mRNA. XM_373469.3
ILMN_1912287 EuUnlPkeXRP9fyO.iQ Homo sapiens Unigene ILMN_77451 ILMN_77451 HS.133181 Hs.133181 Hs.133181 27826545 BX093329 2710020 S 324 GTGCCAGCTGCCATTGCACTGCCTCACATTTTCCTTTAGATGTTTGAGCA BX093329 Soares_parathyroid_tumor_NbHPA Homo sapiens cDNA clone IMAGp998A124183 ; IMAGE:1648403, mRNA sequence BX093329
ILMN_1793729 0flyIEROp.olYSF6n4 Homo sapiens RefSeq ILMN_18382 ILMN_18382 C15ORF39 NM_015492.4 NM_015492.4 56905 153251858 NM_015492.4 C15orf39 NP_056307.2 870110 S 3585 CTTGCCTAGAGAACACACATGGGCTTTGGAGCCCGACAGACCTGGGCTTG 15 + 73290721-73290770 15q24.2a Homo sapiens chromosome 15 open reading frame 39 (C15orf39), mRNA. DKFZP434H132; FLJ46337; MGC117209 DKFZP434H132; FLJ46337; MGC117209 NM_015492.4
ILMN_1889125 fegCQD_j_69DUU38dI Homo sapiens Unigene ILMN_108888 ILMN_108888 HS.545755 Hs.545755 Hs.545755 1999235 AA346998 290020 S 139 CTGGAAAAGCAAAATTTGGATTTGTGGTTCAATCCACCATCTTTACTCAG EST53225 Fetal heart II Homo sapiens cDNA 3 end, mRNA sequence AA346998
ILMN_2296644 BOkEIILakIKIILBOik Homo sapiens RefSeq ILMN_22537 ILMN_22537 PCDHGA9 NM_018921.2 NM_018921.2 56107 14270485 NM_018921.2 PCDHGA9 NP_061744.1 7510243 I 2759 ATGGCAACAAGAAGAAGTCGGGCAAGAAGGAGAAGAAGTAACATGGAGGC 5 + 136035540-136035580:136035581-136035589 5q31.3c Homo sapiens protocadherin gamma subfamily A, 9 (PCDHGA9), transcript variant 1, mRNA. membrane [goid 16020] [evidence IEA]; integral to membrane [goid 16021] [evidence IEA] homophilic cell adhesion [goid 7156] [evidence IEA]; cell adhesion [goid 7155] [evidence IEA] calcium ion binding [goid 5509] [evidence IEA]; protein binding [goid 5515] [evidence IEA] PCDH-GAMMA-A9 PCDH-GAMMA-A9 NM_018921.2
ILMN_1711283 Z7q7I6r2J.XEhc90os Homo sapiens RefSeq ILMN_12044 ILMN_22537 PCDHGA9 NM_018921.2 NM_018921.2 56107 14270485 NM_018921.2 PCDHGA9 NP_061744.1 4180259 A 2220 TGTGGGTGTAGATGGGGTTCGAGCTTTCCTACAGACCTATTCTCAGGAGT 5 + 135929759-135929808 5q31.3c Homo sapiens protocadherin gamma subfamily A, 9 (PCDHGA9), transcript variant 1, mRNA. membrane [goid 16020] [evidence IEA]; integral to membrane [goid 16021] [evidence IEA] homophilic cell adhesion [goid 7156] [evidence IEA]; cell adhesion [goid 7155] [evidence IEA] calcium ion binding [goid 5509] [evidence IEA]; protein binding [goid 5515] [evidence IEA] PCDH-GAMMA-A9 PCDH-GAMMA-A9 NM_018921.2
ILMN_1682799 97CRbQTSEXHToTuvlo Homo sapiens RefSeq ILMN_1387 ILMN_1387 STAMBPL1 NM_020799.2 NM_020799.2 57559 52694663 NM_020799.2 STAMBPL1 NP_065850.1 7150059 S 1746 TGTAAGCACCGTCAACATCAGACACCTACTCATGGACATGTGGTTGCCGG 10 + 90672973-90673022 10q23.31b Homo sapiens STAM binding protein-like 1 (STAMBPL1), mRNA. ubiquitin cycle [goid 6512] [evidence IEA] zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; metallopeptidase activity [goid 8237] [evidence IEA]; ubiquitin thiolesterase activity [goid 4221] [evidence IEA] bA399O19.2; AMSH-LP; ALMalpha; KIAA1373; FLJ31524; AMSH-FP bA399O19.2; AMSH-LP; ALMalpha; KIAA1373; FLJ31524; AMSH-FP NM_020799.2
ILMN_1909767 lFkiX_F2sXQzgj0q30 Homo sapiens Unigene ILMN_104330 ILMN_104330 HS.539137 Hs.539137 Hs.539137 6568782 AW236393 2470450 S 239 ACCGCAGAGCCTTTGACCTCGGTACCTCAATATGAAGATTCAGGGTCTTC xo15e10.x1 NCI_CGAP_Ut2 Homo sapiens cDNA clone IMAGE:2704074 3, mRNA sequence AW236393
ILMN_1840770 ow0oVJA.VYJDqtWup0 Homo sapiens Unigene ILMN_88273 ILMN_88273 HS.372465 Hs.372465 Hs.372465 22919294 BU568994 1470398 S 693 TAATCAGGACCCAGCAAATTTCCCCGAAGCAATGGGGTCCCGGTGGGCTC AGENCOURT_10400114 NIH_MGC_82 Homo sapiens cDNA clone IMAGE:6616301 5, mRNA sequence BU568994
ILMN_1906209 rgIj.rKIqeKeEmqI5Q Homo sapiens Unigene ILMN_108918 ILMN_108918 HS.545796 Hs.545796 Hs.545796 6834513 AW337887 2260747 S 39 GAAAGAGATTTTGGTAGGAGAGGGCTGAGGCTGACAGCGGGGAGATGCCA he12d07.x1 NCI_CGAP_CML1 Homo sapiens cDNA clone IMAGE:2918797 3, mRNA sequence AW337887
ILMN_1665311 KSXe7i6OPSvlIhIFdI Homo sapiens RefSeq ILMN_1785 ILMN_1785 STH NM_001007532.1 NM_001007532.1 246744 56090268 NM_001007532.1 STH NP_001007533.1 5340180 S 97 CAGCCTCTGTGTGAGTGGATGATTCAGGTTGCCAGAGACAGAACCCTCAG 17 + 41432579-41432628 17q21.31e Homo sapiens saitohin (STH), mRNA. MGC163193; MGC163191 MGC163193; MGC163191 NM_001007532.1
ILMN_1657235 xUWKuCKQulcJAIblLs Homo sapiens RefSeq ILMN_36381 ILMN_178946 LOC342979 XM_292820.6 XM_292820.6 342979 113428124 XM_292820.6 LOC342979 XP_292820.6 6110274 A 1452 CCACCGAGGGTGAAGAGGCAAGTGGCCCTAAGCAAAAGACGTGCCAGTGT 19 - 14025431-14025480 19p13.12c PREDICTED: Homo sapiens hypothetical LOC342979 (LOC342979), mRNA. XM_292820.6
ILMN_1655444 6jh6c.oAXq5x5Qers0 Homo sapiens RefSeq ILMN_34624 ILMN_171312 LOC728492 XM_001130874.1 XM_001130874.1 728492 113416615 XM_001130874.1 LOC728492 XP_001130874.1 2570463 I 397 GATGACTGGCTATTTGGAAAACCTGGGTGCTACTGCCAACTGGGTGTATC 5 + 70239388-70239389:70239390-70239437 5q13.2a PREDICTED: Homo sapiens similar to small EDRK-rich factor 1A, telomeric, transcript variant 4 (LOC728492), mRNA. XM_001130874.1
ILMN_1679194 WwEX2r5JUYXRevUsUc Homo sapiens RefSeq ILMN_138375 ILMN_179411 UGT2B7 XM_001128725.1 XM_001128725.1 7364 113416110 XM_001128725.1 UGT2B7 XP_001128725.1 1190064 A 1441 TAAACACCTTCGGGTTGCAGCCCACGACCTCACCTGGTTCCAGTACCACT 4q13.2c PREDICTED: Homo sapiens UDP glucuronosyltransferase 2 family, polypeptide B7 (UGT2B7), mRNA. XM_001128725.1

Total number of rows: 49576

Table truncated, full table size 24753 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6947_HumanHT-12_V3_0_R1_11283641_A.bgx.gz 6.2 Mb (ftp)(http) BGX

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap