NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6884 Query DataSets for GPL6884
Status Public on May 21, 2008
Title Illumina HumanWG-6 v3.0 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description The HumanWG-6 v3.0 Expression BeadChip features up-to-date content derived from the National Center for Biotechnology Information Reference Sequence (NCBI RefSeq) database (Build 36.2, Release 22).

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://www.ncbi.nlm.nih.gov/projects/geo/info/spreadsheet.html
 
Submission date May 21, 2008
Last update date Feb 18, 2019
Organization Illumina Inc.
E-mail expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (8370) GSM344722, GSM344970, GSM344972, GSM344975, GSM344976, GSM344978 
Series (293)
GSE13733 Effects of DZNep and 5-Aza-CdR on gene expression in MCF7 cells
GSE13861 Gene expression signature-based novel prognostic risk score in gastric cancer
GSE14627 Gene expression analysis of SH-SY5Y neuroblastoma cells overexpressing ZNF423

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
Species
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Unigene_ID Unigene id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome build 36 version 3
Cytoband
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq
GB_ACC

Data table
ID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Unigene_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Array_Address_Id Probe_Type Probe_Start SEQUENCE Chromosome Probe_Chr_Orientation Probe_Coordinates Cytoband Definition Ontology_Component Ontology_Process Ontology_Function Synonyms GB_ACC
ILMN_1825594 Homo sapiens Unigene ILMN_89282 ILMN_89282 HS.388528 Hs.388528 Hs.388528 23525203 BU678343 1740241 S 349 CTCTCTAAAGGGACAACAGAGTGGACAGTCAAGGAACTCCACATATTCAT UI-CF-EC0-abi-c-12-0-UI.s1 UI-CF-EC0 Homo sapiens cDNA clone UI-CF-EC0-abi-c-12-0-UI 3, mRNA sequence BU678343
ILMN_1810803 Homo sapiens RefSeq ILMN_35826 ILMN_35826 LOC441782 XM_497527.2 XM_497527.2 441782 89042416 XM_497527.2 LOC441782 XP_497527.2 1850750 S 902 GGGGTCAAGCCCAGGTGAAATGTGGATTGGAAAAGTGCTTCCCTTGCCCC PREDICTED: Homo sapiens similar to spectrin domain with coiled-coils 1 (LOC441782), mRNA. XM_497527.2
ILMN_1722532 Homo sapiens RefSeq ILMN_25544 ILMN_25544 JMJD1A NM_018433.3 NM_018433.3 55818 46358420 NM_018433.3 JMJD1A NP_060903.2 1240504 S 4359 CCAGGCTGTAAAAGCAAAACCTCGTATCAGCTCTGGAACAATACCTGCAG 2 + 86572991-86573040 2p11.2e Homo sapiens jumonji domain containing 1A (JMJD1A), mRNA. nucleus [goid 5634] [evidence IEA] chromatin modification [goid 16568] [evidence IEA]; transcription [goid 6350] [evidence IEA]; regulation of transcription, DNA-dependent [goid 6355] [evidence IEA] oxidoreductase activity [goid 16491] [evidence IEA]; oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [goid 16702] [evidence IEA]; zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; iron ion binding [goid 5506] [evidence IEA] JHMD2A; JMJD1; TSGA; KIAA0742; DKFZp686A24246; DKFZp686P07111 NM_018433.3
ILMN_1884413 Homo sapiens Unigene ILMN_132331 ILMN_132331 HS.580150 Hs.580150 Hs.580150 7376124 AW629334 4050487 S 117 CCAGACAGGAAGCATCAAGCCCTTCAGGAAAGAATATGCGAGAGTGCTGC hi56g05.x1 Soares_NFL_T_GBC_S1 Homo sapiens cDNA clone IMAGE:2976344 3, mRNA sequence AW629334
ILMN_1906034 Homo sapiens Unigene ILMN_105017 ILMN_105017 HS.540210 Hs.540210 Hs.540210 5437312 AI818233 2190598 S 304 TGTGCAGAAAGCTGATGGAAGGGAGAAAGAATGGAAGTGGGTCACACAGC wk77d04.x1 NCI_CGAP_Pan1 Homo sapiens cDNA clone IMAGE:2421415 3, mRNA sequence AI818233
ILMN_1861479 Homo sapiens Unigene ILMN_75398 ILMN_75398 HS.116531 Hs.116531 Hs.116531 20360910 BQ185359 3060086 S 486 GCGCCTTCCGACAAGGAAAGTGTTTAGTGTCCATCGGTCTGGTGGGTGGC UI-E-EJ1-aju-p-07-0-UI.s1 UI-E-EJ1 Homo sapiens cDNA clone UI-E-EJ1-aju-p-07-0-UI 3, mRNA sequence BQ185359
ILMN_1708805 Homo sapiens RefSeq ILMN_10519 ILMN_10519 NCOA3 NM_006534.2 NM_006534.2 8202 32307123 NM_006534.2 NCOA3 NP_006525.2 2760390 A 7834 CCACATGAAATGACTTATGGGGGATGGTGAGCTGTGACTGCTTTGCTGAC 20 + 45718934-45718983 20q13.12c Homo sapiens nuclear receptor coactivator 3 (NCOA3), transcript variant 2, mRNA. nucleus [goid 5634] [pmid 9267036] [evidence NAS] positive regulation of transcription, DNA-dependent [goid 45893] [pmid 15572661] [evidence NAS]; androgen receptor signaling pathway [goid 30521] [pmid 15572661] [evidence NAS]; signal transduction [goid 7165] [evidence IEA] acyltransferase activity [goid 8415] [evidence IEA]; thyroid hormone receptor binding [goid 46966] [pmid 9346901] [evidence NAS]; transferase activity [goid 16740] [evidence IEA]; transcription coactivator activity [goid 3713] [pmid 15572661] [evidence NAS]; androgen receptor binding [goid 50681] [pmid 15572661] [evidence NAS]; histone acetyltransferase activity [goid 4402] [pmid 9267036] [evidence TAS]; signal transducer activity [goid 4871] [evidence IEA]; transcription regulator activity [goid 30528] [evidence IEA]; protein binding [goid 5515] [pmid 15698540] [evidence IPI] CAGH16; TNRC14; pCIP; ACTR; MGC141848; CTG26; AIB-1; TRAM-1; TNRC16; AIB1; SRC3; SRC-1; RAC3 NM_006534.2
ILMN_1874224 Homo sapiens Unigene ILMN_117209 ILMN_117209 HS.564563 Hs.564563 Hs.564563 3246329 AI026841 5860133 S 137 GGGTGGAGTGATTGCTACCTCCAGGCATGATCTTTGTCACCTGGCTGAGG ow02h05.x1 Soares_testis_NHT Homo sapiens cDNA clone IMAGE:1645689 3 similar to contains Alu repetitive element;, mRNA sequence AI026841
ILMN_1672526 Homo sapiens RefSeq ILMN_17234 ILMN_17234 LOC389834 NM_001013655.1 NM_001013655.1 389834 61966764 NM_001013655.1 LOC389834 NP_001013677.1 1740239 S 3938 CCATTGGTTCTGTTTGGCATAACCCTATTAAATGGTGCGCAGAGCTGAAT 4 - 51062-51111 Homo sapiens hypothetical gene supported by AK123403 (LOC389834), mRNA. NM_001013655.1
ILMN_2185604 Homo sapiens RefSeq ILMN_19244 ILMN_19244 C17ORF77 NM_152460.2 NM_152460.2 146723 48255961 NM_152460.2 C17orf77 NP_689673.2 6550343 S 2372 CTGCTCCAGTGAAGGGTGCACCAAAATCTCAGAAGTCACTGCTAAAGACC 17 + 70101790-70101839 17q25.1b Homo sapiens chromosome 17 open reading frame 77 (C17orf77), mRNA. FLJ31882 NM_152460.2
ILMN_1785107 Homo sapiens RefSeq ILMN_1567 ILMN_1567 NXT2 NM_018698.3 NM_018698.3 55916 21361723 NM_018698.3 NXT2 NP_061168.2 5270307 S 2605 ATGGCTGGAACTACTCGTATAAGGACTAGACTGTATTTTTGACATGCTCC X + 108674482-108674531 Xq22.3c Homo sapiens nuclear transport factor 2-like export factor 2 (NXT2), mRNA. intracellular [goid 5622] [evidence IEA]; nucleus [goid 5634] [evidence IEA] mRNA processing [goid 6397] [evidence IEA]; transport [goid 6810] [evidence IEA]; protein transport [goid 15031] [evidence IEA] transporter activity [goid 5215] [evidence IEA] P15-2 NM_018698.3
ILMN_1810805 Homo sapiens RefSeq ILMN_25274 ILMN_25274 KIAA1414 NM_019024.1 NM_019024.1 54497 55749741 NM_019024.1 KIAA1414 NP_061897.1 360577 S 6243 GGCTGCCAGACAACCAGCCCCCGCCATACATTCTGCACCAACAATTAAGC 2 - 37062156-37062205 2p22.2b Homo sapiens HEAT repeat containing 5B (HEATR5B), mRNA. binding [goid 5488] [evidence IEA] KIAA1414 NM_019024.1
ILMN_1689711 Homo sapiens RefSeq ILMN_2520 ILMN_2520 CHKB NM_152253.1 NM_152253.1 1120 23238260 NM_152253.1 CHKB NP_689466.1 5810382 I 953 CTAAATAAAAATAGACCAACGCTAAAGCCTGTGCTCCAGAGCCTCCAGGC 22q13.33b Homo sapiens choline kinase beta (CHKB), transcript variant 2, mRNA. transferase activity [goid 16740] [evidence IEA]; ethanolamine kinase activity [goid 4305] [evidence IEA] CHKL; CHETK NM_152253.1
ILMN_1782551 Homo sapiens RefSeq ILMN_17249 ILMN_17249 E2F5 NM_001951.2 NM_001951.2 1875 12669916 NM_001951.2 E2F5 NP_001942.1 6650196 S 957 CTTCTGACGTGTTTCCTCTCTTAAGGCTTTCTCCTACCCCGGCAGATGAC 8 + 86311683-86311691:86313240-86313280 8q21.2b Homo sapiens E2F transcription factor 5, p130-binding (E2F5), mRNA. transcription factor complex [goid 5667] [evidence IEA]; nucleus [goid 5634] [evidence IEA] transcription [goid 6350] [evidence IEA]; regulation of transcription, DNA-dependent [goid 6355] [evidence IEA] protein binding [goid 5515] [pmid 7760804] [evidence TAS]; transcription factor activity [goid 3700] [pmid 7892279] [evidence NAS] E2F-5 NM_001951.2
ILMN_1820586 Homo sapiens Unigene ILMN_132251 ILMN_132251 HS.580070 Hs.580070 Hs.580070 15448569 BI561255 130487 S 546 GAAGACAGGGGAGGGACTTAGCCTTTCGGAGCTTGACCAGCATGTGGAAG 603256406F1 NIH_MGC_97 Homo sapiens cDNA clone IMAGE:5298936 5, mRNA sequence BI561255
ILMN_1838256 Homo sapiens Unigene ILMN_118745 ILMN_118745 HS.566417 Hs.566417 Hs.566417 5887203 AW028447 3450520 S 103 TTAAAGAACCAGGAAATGTAGAAAATTAGTTGCCTGTCCATAGGGATCTT wv89c11.x1 NCI_CGAP_Gas4 Homo sapiens cDNA clone IMAGE:2541332 3, mRNA sequence AW028447
ILMN_1901322 Homo sapiens Unigene ILMN_103363 ILMN_103363 HS.537570 Hs.537570 Hs.537570 33197153 CF123192 2710554 S 171 CATTGTGCAAAGTCATGCTGCTTCGAATTATGCTGCGCGCTGGCACACAG UI-HF-CH0.1-aue-b-02-0-UI.r1 NIH_MGC_211 Homo sapiens cDNA clone IMAGE:30573133 5, mRNA sequence CF123192
ILMN_1715540 Homo sapiens RefSeq ILMN_2384 ILMN_2384 TRAIP NM_005879.2 NM_005879.2 10293 40807468 NM_005879.2 TRAIP NP_005870.2 7380347 S 1609 TCGGGACCAGCCTGAGGTGTAAGGGCAGACAAACAGGTGAGGGTGAGTGT 3 - 49841397-49841446 3p21.31c Homo sapiens TRAF interacting protein (TRAIP), mRNA. cell proliferation [goid 8283] [pmid 9104814] [evidence TAS]; induction of apoptosis [goid 6917] [pmid 9104814] [evidence TAS]; signal transduction [goid 7165] [pmid 9104814] [evidence TAS] metal ion binding [goid 46872] [evidence IEA]; zinc ion binding [goid 8270] [evidence IEA]; protein binding [goid 5515] [evidence IEA] TRIP; RNF206 NM_005879.2
ILMN_2371280 Homo sapiens RefSeq ILMN_21047 ILMN_21047 CSF3R NM_172313.1 NM_172313.1 1441 27437044 NM_172313.1 CSF3R NP_758519.1 6270114 A 2459 GACCAGATCATGCTCCATCCAGCCCCACCCAATGGCCTTTTGTGCTTGTT 1 - 36704305-36704354 1p34.3d Homo sapiens colony stimulating factor 3 receptor (granulocyte) (CSF3R), transcript variant 4, mRNA. integral to plasma membrane [goid 5887] [pmid 7542747] [evidence TAS]; membrane [goid 16020] [evidence IEA] cell adhesion [goid 7155] [evidence IEA]; defense response [goid 6952] [pmid 7542747] [evidence TAS]; signal transduction [goid 7165] [pmid 1371413] [evidence NAS] receptor activity [goid 4872] [pmid 7542747] [evidence TAS]; hematopoietin/interferon-class (D200-domain) cytokine receptor activity [goid 4896] [evidence IEA]; protein binding [goid 5515] [evidence IEA] GCSFR; CD114 NM_172313.1
ILMN_1891455 Homo sapiens Unigene ILMN_120510 ILMN_120510 HS.568329 Hs.568329 Hs.568329 51466998 XM_499121 7650730 S 4333 GGATGACCCTGCAAAGCCCAGCCAACGATAGCAAAGCCACAGCAGACTTG PREDICTED: Homo sapiens hypothetical gene supported by BX538329 (LOC441366), mRNA XM_499121

Total number of rows: 48803

Table truncated, full table size 25638 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6884_HumanWG-6_V3_0_R0_11282955_A.bgx.gz 6.3 Mb (ftp)(http) BGX

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap