NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6546 Query DataSets for GPL6546
Status Public on Mar 15, 2008
Title Agilent-016989 Synechocystis sp. PCC 6803 8x15K custom array
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Synechocystis sp. PCC 6803
Manufacturer Agilent Technologies
Manufacture protocol Agilent’s SurePrint technology
8x15K custom design
 
 
Contributor(s) Hess W, Wilde A
Submission date Mar 04, 2008
Last update date Jul 14, 2014
Contact name Hans-Joachim Mollenkopf
E-mail mollenkopf@mpiib-berlin.mpg.de
Phone +49 30 28460 482
Organization name Max-Planck-Institute for Infection Biology
Lab Microarray/Genomics Core Facility
Street address Charitéplatz 1
City Berlin
ZIP/Postal code 10117
Country Germany
 
Samples (34) GSM270625, GSM270632, GSM270633, GSM270634, GSM270635, GSM270643 
Series (2)
GSE10708 The orthologue of the RNA chaperone Hfq is essential for cell motility of the cyanobacterium Synechocystis PCC 6803
GSE31672 Comparison of carboxysomal (ccmM) and photorespiratory (glcD1/D2) mutants of Synechocystis sp. PCC 6803 using metabolic and transcriptomic phenotyping

Data table header descriptions
ID
Row Feature location: row
Col Feature location: column
SEQUENCE Probe sequence (sequence of bases printed on the array)
ProbeUID Unique integer for each unique probe in a design
ControlType Feature control type (0=control type none, 1=positive control, -1=negative control, -20000=not probe, -30000=ignore)
ProbeName Agilent-assigned identifier for the probe synthesized on the microarray
ORF Identifier for the gene for which the probe provides expression information
SystematicName Identifier for the target sequence that the probe was designed to hybridize with
SPOT_ID spot identifier

Data table
ID Row Col SEQUENCE ProbeUID ControlType ProbeName ORF SystematicName SPOT_ID
1 1 1 0 1 GE_BrightCorner GE_BrightCorner --CONTROL: GE_BrightCorner
2 1 2 1 1 DarkCorner DarkCorner --CONTROL: DarkCorner
3 1 3 1 1 DarkCorner DarkCorner --CONTROL: DarkCorner
4 1 4 GCCTGCCTACCGGATCACCGATTCGGGTTTGATCAATGCTTATCCTGTTTCTCCTCCTGT 3 0 sll1862_252 sll1862 sll1862
5 1 5 GGGAATCTTCCCCCCAAATCTGTCCTGTGCCTATCGACCAACAGCCGGTCAACGAATATG 5 0 sll0584_14 sll0584 sll0584
6 1 6 TTAGATGTGGCAGAGAGGGCTGGCGTATTTATTCCCACGGGCTGTTTAATGGGTTCCTGC 7 0 ssr1041_67 ssr1041 ssr1041
7 1 7 TGGATTGCCCTTTCCAGTATTGCTCCCATCGGGTTGTTGATGTCTGGTTATGCTTCCAAT 9 0 sll0519_403 sll0519 sll0519
8 1 8 GGCATCACGGGGCAAGATGGCTCCTATCTGAGTGAATTGTTGTTGGAAAAGGGCTACCAA 11 0 sll1212_31 sll1212 sll1212
9 1 9 GGGTGATCCAATACATCCAACTCAGTGCCCCCACGCCGGAACCGAAACTATACGGTTTTT 13 0 slr0926_755 slr0926 slr0926
10 1 10 TGCTTGGGCATTCACAGAGTTGCGTTGCAGTTTTGAAAATCGGTCTATTGTTCCTGATTT 15 0 sll1250_207 sll1250 sll1250
11 1 11 TCGCTCCCACCTCAACCAGGACTTGCGCGATCGGTACGGCACTTAATTTTTTTTTTTTTT 17 0 sll0395_594 sll0395 sll0395
12 1 12 TGGCCCAATCTCAAAGTATTACCTGCTTGAGGGAGGGCAGTTTTATTACCTGTCCTGGCT 19 0 slr0522_68 slr0522 slr0522
13 1 13 ACTAAAGCCGCCATTGATATATCTTCCGGCGATCGGGAGGCTAGGGCTTTTTTTTTTTTT 21 0 sll1871_1021 sll1871 sll1871
14 1 14 CCCAGCGGATACGGTGGATCAACCCCTGCGGGCGTTAATTTTTGACAGTTATTACGATGC 23 0 slr0604_561 slr0604 slr0604
15 1 15 CACTGACCACGCCACCCTGGAGAAACTTCAAGGAGACCACCCCATTATTGATGCGATTCT 25 0 slr0707_1956 slr0707 slr0707
16 1 16 TTGCAGTCCTGGTATGAGTATTTGGATCAATGGCAACTCCAACACTATTCGCCGTTGGTT 27 0 sll1432_781 sll1432 sll1432
17 1 17 TGTCTTTGACCCGCAAGGAATACAGCATTCTGGAATTACTACTCCGCAATGGCCGTCGGT 29 0 slr1584_443 slr1584 slr1584
18 1 18 GCCAGTCTGTTCACAATCAATGCCTACCTAACTTCAGCCCAAGCGGAAAGGGTAGAAGCG 31 0 sll2008_949 sll2008 sll2008
19 1 19 GGGGGATTGCCGCAAGGAAGACCTGATTAAAGAACAGCTAAAAACCGCCGATGTCTTTTT 33 0 sll0576_165 sll0576 sll0576
20 1 20 GGTGGGGTCTGCCTGTGTAACGGCCTATCGGGTGGGAGGGCGTAAAGTTTTTTTTTTTTT 35 0 sll0504_978 sll0504 sll0504

Total number of rows: 15744

Table truncated, full table size 1638 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap