NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6466 Query DataSets for GPL6466
Status Public on Feb 06, 2008
Title Agilent-011978 Mouse Microarray G4121A (Probe Name version)
Technology type in situ oligonucleotide
Distribution commercial
Organism Mus musculus
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
Catalog number G4121A
 
Description Mouse is the most widely used mammalian model in biological research and target identification. This microarray will enable researchers to simultaneously characterize expression activities of many thousands of mouse genes associated with various biological functions and processes. Content for this empirically validated microarray includes a comprehensive set of toxicology markers determined through collaboration with leaders in toxicogenomics including NIEHS, Toxicogenomics Research Consortium, and Paradigm Genetics

*** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL891.
 
Submission date Feb 06, 2008
Last update date Apr 06, 2012
Organization Agilent Technologies
E-mail cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (1015) GSM263151, GSM263152, GSM263153, GSM263154, GSM263155, GSM263156 
Series (8)
GSE10415 7 Brain Regions in 20 Inbred Strains of Laboratory Mice
GSE14563 Liver gene expression in a panel of laboratory inbred mouse strains
GSE14675 Identification of Hedgehog Signaling and Novel Transcription Factors Involved in Regulation of Systemic Response to LPS
Relations
Alternative to GPL891

Data table header descriptions
ID Agilent feature number
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeq Accession number
GB_ACC GenBank Accession number
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence

Data table
ID SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
A_51_P100021 A_51_P100021 FALSE AY454345 16656 Hivep3 human immunodeficiency virus type I enhancer binding protein 3 Mm.302758 gb|AY454345|tc|TC1584815|nap|NAP057482-1 chr4:119807944-119808005 mm|4qD2.1 Mus musculus clone pZAS3 328-2275 zinc finger protein ZAS3 (Krc) mRNA, partial cds; alternatively spliced. [AY454345] "GO:0003676(nucleic acid binding)|GO:0003677(DNA binding)|GO:0005622(intracellular)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0006350(transcription)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0008270(zinc ion binding)|GO:0016563(transcription activator activity)|GO:0045941(positive regulation of transcription)|GO:0046872(metal ion binding)" CATGGCTGGATTAACGTATGTGTGTGGTATATAGATACACAGAGAGAAACCAAAGTGGTG
A_51_P100034 A_51_P100034 FALSE NM_027162 NM_027162 69674 Mif4gd MIF4G domain containing Mm.390387 ENSMUST00000021087 ref|NM_027162|gb|BC055812|ens|ENSMUST00000021087|ens|ENSMUST00000106507 chr11:115469328-115469269 mm|11qE2 Mus musculus MIF4G domain containing (Mif4gd), mRNA [NM_027162] GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0006417(regulation of translation)|GO:0016070(RNA metabolic process) GAGACTTTTGTGGAGGAAGCCTGTTTCCTCCAGTCATGAGTGACTGCCTCACCAGGTTGG
A_51_P100052 A_51_P100052 FALSE NM_198863 NM_198863 245450 Slitrk2 SLIT and NTRK-like family, member 2 Mm.336081 ENSMUST00000036043 ref|NM_198863|gb|BC112406|ens|ENSMUST00000036043|gb|AK044761 chrX:63908145-63908204 mm|XqA7.1 Mus musculus SLIT and NTRK-like family, member 2 (Slitrk2), mRNA [NM_198863] GO:0003674(molecular_function)|GO:0005515(protein binding)|GO:0007409(axonogenesis)|GO:0016020(membrane)|GO:0016021(integral to membrane) CTAAATGTGAATTGCCAAGAAAGGAAGTTCACTAACATCTCTGACCTACAGCCCAAACCT
A_51_P100065 A_51_P100065 FALSE NM_010727 NM_010727 16924 Lnx1 ligand of numb-protein X 1 Mm.440403 ENSMUST00000121690 ref|NM_010727|gb|AK138326|gb|AF034745|ens|ENSMUST00000121690 chr5:74993856-74993432 mm|5qC3.3 Mus musculus ligand of numb-protein X 1 (Lnx1), mRNA [NM_010727] GO:0004842(ubiquitin-protein ligase activity)|GO:0005515(protein binding)|GO:0005737(cytoplasm)|GO:0006511(ubiquitin-dependent protein catabolic process)|GO:0008270(zinc ion binding)|GO:0016874(ligase activity)|GO:0030165(PDZ domain binding)|GO:0042787(protein ubiquitination during ubiquitin-dependent protein catabolic process)|GO:0046872(metal ion binding)|GO:0051260(protein homooligomerization) TTTTTTATCAAGTCCATTGTTGAAGGAACACCTGCATACAATGACGGAAGAATCAGATGT
A_51_P100084 A_51_P100084 FALSE nap|NAP091803-1 chr11:014500192-014500247 mm|11qA2 AAGTCATCTCTCATGCCTATCAGAATACTCTGCCTCTAAGCCCAAATCAACATCTTAAAA
A_51_P100099 A_51_P100099 FALSE AK011292 69886 2610002J23Rik RIKEN cDNA 2610002J23 gene Mm.391799 gb|AK011292|riken|2610002J23|tc|TC1611660|tc|TC1626427 chr11:100318948-100318889 mm|11qD Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610002J23 product:unclassifiable, full insert sequence [AK011292] TTTTGTTGTTTTACTTACAGCATATGTTCTGGTGATTGAAAACCAAACAGTTATGGAGGG
A_51_P100101 A_51_P100101 FALSE NM_130904 NM_130904 170779 Cd209d CD209d antigen Mm.111026 ENSMUST00000011445 ref|NM_130904|gb|AK136586|ens|ENSMUST00000011445|ens|ENSMUST00000111028 chr8:3872060-3872001 mm|8qA1.1 Mus musculus CD209d antigen (Cd209d), mRNA [NM_130904] GO:0004872(receptor activity)|GO:0005488(binding)|GO:0005509(calcium ion binding)|GO:0005529(sugar binding)|GO:0005537(mannose binding)|GO:0006897(endocytosis)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0042803(protein homodimerization activity)|GO:0046872(metal ion binding) ATTGTGCAGAGTTCTCTGGGGATGGCTGGAATGATCTCAGTTGTGATAAACTACTTTTCT
A_51_P100123 A_51_P100123 FALSE AF199608 14168 Fgf13 fibroblast growth factor 13 Mm.7995 gb|AF199608|gb|CJ065248|tc|TC1636277 chrX:56838737-56838678 mm|XqA6 Mus musculus fibroblast growth factor homologous factor 2 isoform 1P+1Y'+1V (FHF-2) mRNA, partial cds. [AF199608] GO:0000165(MAPKKK cascade)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0008083(growth factor activity)|GO:0030295(protein kinase activator activity) TGATGCAGACTCTTGGAAACCTCAGAAACGCATGGTGACGATATGACCAAGAATCTTCCT
A_51_P100155 A_51_P100155 FALSE NM_027371 NM_027371 70285 Bxdc5 brix domain containing 5 Mm.28128 ENSMUST00000029838 ref|NM_027371|gb|BC089369|ens|ENSMUST00000029838|gb|AK010079 chr3:146170053-146169498 mm|3qH2 Mus musculus brix domain containing 5 (Bxdc5), transcript variant 2, mRNA [NM_027371] GO:0003723(RNA binding)|GO:0005634(nucleus)|GO:0006364(rRNA processing)|GO:0019843(rRNA binding)|GO:0042254(ribosome biogenesis) TACGAAGGGGTCCACAAGCCACGGGAAATGGATACAAGTCGAAGGAAATTCCACTTATAA
A_51_P100174 A_51_P100174 FALSE NM_008613 NM_008613 17427 Mns1 meiosis-specific nuclear structural protein 1 Mm.387671 ENSMUST00000034746 ref|NM_008613|gb|AK013048|ens|ENSMUST00000034746|gb|D14849 chr9:72306274-72306333 mm|9qD Mus musculus meiosis-specific nuclear structural protein 1 (Mns1), mRNA [NM_008613] GO:0005634(nucleus)|GO:0005635(nuclear envelope)|GO:0005882(intermediate filament)|GO:0007126(meiosis) CTGTTTTACAGTTGGTGACAGTAGGCCCTGGTCTATCTGCATGTTCTAAAACATCCTCCT
A_51_P100180 A_51_P100180 FALSE chrX:012253522-012253474 mm|XqA1.1 TGGTGTGATTCAAATGTCTTCTGATAACTTGATGTTATTTGGAGGAGTTCAGTAAGATTG
A_51_P100208 A_51_P100208 FALSE NM_177906 NM_177906 330908 Opcml opioid binding protein/cell adhesion molecule-like Mm.379474 ENSMUST00000115243 ref|NM_177906|gb|BC076581|ens|ENSMUST00000115243|gb|AK048730 chr9:28731887-28731946 mm|9qA4 Mus musculus opioid binding protein/cell adhesion molecule-like (Opcml), mRNA [NM_177906] TTTGGGTTTTCTTTGGCATAAACCTTATTTCTAGAAATCCTCATGTCCAATTGCTTTCCC
A_51_P100218 A_51_P100218 FALSE NM_134198 NM_134198 171232 V1rf1 vomeronasal 1 receptor, F1 Mm.377189 ENSMUST00000079633 ref|NM_134198|gb|BC127026|ens|ENSMUST00000079633|tc|NP496264 chr17:21366635-21366694 mm|17qA3.2 Mus musculus vomeronasal 1 receptor, F1 (V1rf1), mRNA [NM_134198] GO:0004872(receptor activity)|GO:0005550(pheromone binding)|GO:0005887(integral to plasma membrane)|GO:0016503(pheromone receptor activity)|GO:0019236(response to pheromone) TTTAGTTAATCTTACCTGGCATCTAGTGAGTATCCATGCAATATTCTCAATGTGTTTTGC
A_51_P100227 A_51_P100227 FALSE NM_023579 NM_023579 70572 Ipo5 importin 5 Mm.221452 ENSMUST00000032898 ref|NM_023579|ens|ENSMUST00000032898|gb|AK079134|gb|AF294327 chr14:121346888-121346947 mm|14qE5 Mus musculus importin 5 (Ipo5), mRNA [NM_023579] "GO:0000059(protein import into nucleus, docking)|GO:0005488(binding)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005643(nuclear pore)|GO:0005737(cytoplasm)|GO:0006810(transport)|GO:0006886(intracellular protein transport)|GO:0008565(protein transporter activity)|GO:0015031(protein transport)" GATCCAAACGTTTTGGCTTAGGATTTCCATTGCAGATTGTAATTGCTTTAGAGACACACG
A_51_P100238 A_51_P100238 FALSE NM_146376 NM_146376 258373 Olfr323 olfactory receptor 323 Mm.377463 ENSMUST00000070804 ref|NM_146376|ens|ENSMUST00000070804|gb|BC146611|tc|TC1599732 chr11:58438789-58438730 mm|11qB1.3 Mus musculus olfactory receptor 323 (Olfr323), mRNA [NM_146376] GO:0004872(receptor activity)|GO:0004984(olfactory receptor activity)|GO:0007186(G-protein coupled receptor protein signaling pathway)|GO:0007608(sensory perception of smell)|GO:0016021(integral to membrane) GGACCATGATCTCCATGTATGTGCGCCCAAATGCACATCTGTCACCGGAACTCAACAAGG
A_51_P100246 A_51_P100246 FALSE NM_145578 NM_145578 22192 Ube2m ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)" Mm.196580 ENSMUST00000005714 ref|NM_145578|ens|ENSMUST00000005714|gb|AK210056|gb|BC021792 chr7:13621239-13621093 mm|7qA1 Mus musculus ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) (Ube2m), mRNA [NM_145578] GO:0005524(ATP binding)|GO:0006464(protein modification process)|GO:0006511(ubiquitin-dependent protein catabolic process)|GO:0016874(ligase activity)|GO:0016881(acid-amino acid ligase activity)|GO:0019787(small conjugating protein ligase activity)|GO:0043687(post-translational protein modification)|GO:0051246(regulation of protein metabolic process) AGTCCTTACGATAAACTCCATAATTTATGGCCTGCAGTATCTCTTCTTGGAGCCGAACCC
A_51_P100262 A_51_P100262 FALSE nap|NAP057070-1 chr9:19829174-19829115 mm|9qA3 CTTCATTTAGAGTCTGAGGATCAAAGGCATTAAAGATGCACCAAGAAGAATCCACAGCAG
A_51_P100289 A_51_P100289 FALSE NM_020493 NM_020493 20807 Srf serum response factor Mm.45044 ref|NM_020493|tc|TC1577357|tc|TC1718111|nap|NAP098796-001 chr17:46683795-46683788 mm|17qC Mus musculus serum response factor (Srf), mRNA [NM_020493] GO:0001829(trophectodermal cell differentiation)|GO:0001947(heart looping)|GO:0003677(DNA binding)|GO:0003700(transcription factor activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0006350(transcription)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0007275(multicellular organismal development)|GO:0007507(heart development)|GO:0043565(sequence-specific DNA binding)|GO:0045597(positive regulation of cell differentiation)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0046716(muscle maintenance) GGTGTATCCCTAATTAAGTGCCTCTAGGGGTGTGTGCGCGCGCCTGTGTCCTGAGTGAAT
A_51_P100296 A_51_P100296 FALSE NM_152220 NM_152220 20908 Stx3 syntaxin 3 Mm.272264 ENSMUST00000112964 ref|NM_152220|ens|ENSMUST00000112964|ens|ENSMUST00000112965|ens|ENSMUST00000069285 chr19:11856161-11856102 mm|19qA Mus musculus syntaxin 3 (Stx3), transcript variant A, mRNA [NM_152220] GO:0005484(SNAP receptor activity)|GO:0006810(transport)|GO:0006836(neurotransmitter transport)|GO:0006886(intracellular protein transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016192(vesicle-mediated transport) ATTATCATTGTGGTAGTAGTTGTGTTGCTGGGCATTTTAGCGTTGATTATTGGACTGTCC
A_51_P100312 A_51_P100312 FALSE NM_001039652 NM_001039652 18390 Oprm1 opioid receptor, mu 1" Mm.457998 ref|NM_001039652|gb|AF260307|gb|AF260308|gb|AF260306 chr10:3516345-3516286 mm|10qA1 Mus musculus opioid receptor, mu 1 (Oprm1), mRNA [NM_001039652] "GO:0004871(signal transducer activity)|GO:0004872(receptor activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004985(opioid receptor activity)|GO:0004988(mu-opioid receptor activity)|GO:0005624(membrane fraction)|GO:0005886(plasma membrane)|GO:0007165(signal transduction)|GO:0007186(G-protein coupled receptor protein signaling pathway)|GO:0007191(dopamine receptor, adenylate cyclase activating pathway)|GO:0007193(G-protein signaling, adenylate cyclase inhibiting pathway)|GO:0007610(behavior)|GO:0007626(locomotory behavior)|GO:0016020(membrane)|GO:0016021(integral to membrane)" TGGCTGTATTTATTGTCTGCTGGACCCCCATCCACATCTATGTCATCATCAAAGCACTGA

Total number of rows: 20930

Table truncated, full table size 11736 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap