GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Platform GPL6105 Query DataSets for GPL6105
Status Public on Dec 13, 2007
Title Illumina mouse-6 v1.1 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Mus musculus
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
Description The MouseWG-6 v1.1 Expression BeadChip contains six wholegenome gene expression arrays allowing six samples to be hybridized to a single chip. BeadChip content was created by combining proven sources, including the Mouse Exonic Evidence Based Oligonucleotide (MEEBO) set, the RIKEN FANTOM 22-5 database, and the National Center for Biotechnology Information (NCBI) Reference Sequence (RefSeq) database.

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at
Submission date Nov 08, 2007
Last update date Jan 18, 2013
Organization Illumina Inc.
Phone 1 800 809 4566
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
Samples (1305) GSM289002, GSM289035, GSM289037, GSM289039, GSM289042, GSM289043 
Series (76)
GSE11472 Gene expression signature of cerebellum hypoplasia in a mouse model of Down syndrome (Part II).
GSE12882 Replacing skeletal muscle alpha-actin with cardiac actin in mouse skeletal muscle
GSE13190 Global gene-expression analyses of the Esrrb reprogrammed cells and Esrrb knockdown cells
Alternative to GPL6238
Alternative to GPL6481
Alternative to GPL6568
Alternative to GPL8081
Alternative to GPL15943

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome built
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq
Obsolete_Probe_Id Identifier of probe id before bgx time

Data table
ID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Array_Address_Id GB_ACC SPOT_ID Probe_Type Probe_Start SEQUENCE Chromosome Probe_Chr_Orientation Probe_Coordinates Definition Ontology_Component Ontology_Process Ontology_Function Synonyms Obsolete_Probe_Id
ILMN_1243094 Mus musculus Riken ri|C730035M01|PX00087M15|AK050300|1404 ILMN_204164 THRSP ri|C730035M01|PX00087M15|AK050300|1404 AK050300 Thrsp 102690609 AK050300 S 1127 GCCCTGCCTGACCTGGAAACGTAGAGATTCTTCTGCCTCAGGTTCCAGAG ri|C730035M01|PX00087M15|AK050300|1404-S-1
ILMN_1240307 Mus musculus RefSeq XM_146216.2 ILMN_198854 LOC233991 XM_146216.2 XM_146216.2 38089106 XM_146216.2 LOC233991 105420348 XM_146216.2 S 3 GCTGGTGAGAGAACTGGAGGCCATAAAAGAAGATGGAATCATGGATGCTG GI_38089106-S-1
ILMN_2486639 Mus musculus MEEBO scl33145.14_332 ILMN_192283 PRPF31 scl33145.14_332 31980641 NM_027328 Prpf31 104210685 NM_027328 S 14 TCGTAGTCCCCCGTGGGTCTGTTGGGGAAAGCCCTTTGTCTGTCACTTCC scl33145.14_332-S-2
ILMN_1229397 Mus musculus RefSeq scl020510.12_56 ILMN_208829 SLC1A1 NM_009199.2 NM_009199.2 20510 118130482 NM_009199.2 Slc1a1 NP_033225.1 520372 NM_009199.2 S 2256 CAATGTACTGTATTGAGACACTGGTAGCTGACAGCCAGTGTTCGGTATAG Mus musculus solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 (Slc1a1), mRNA. XM_001002173 XM_001002184 XM_001002198 XM_001002207 integral to membrane [goid 16021] [evidence IEA]; integral to plasma membrane [goid 5887] [evidence IEA]; membrane [goid 16020] [evidence IEA] transport [goid 6810] [evidence IEA]; dicarboxylic acid transport [goid 6835] [evidence IEA] symporter activity [goid 15293] [evidence IEA]; sodium:dicarboxylate symporter activity [goid 17153] [evidence IEA]; carrier activity [goid 5386] [evidence IEA]; glutamate:sodium symporter activity [goid 15501] [evidence IDA] EAAC1; D130048G10Rik; MEAAC1; EAAC2; EAAT3 scl020510.12_56-S-1
ILMN_1225873 Mus musculus RefSeq scl020510.12_56 ILMN_208829 SLC1A1 NM_009199.2 NM_009199.2 20510 118130482 NM_009199.2 Slc1a1 NP_033225.1 6420059 NM_009199.2 S 3552 CAGGTGGTTCTCCTTAGTGGCAGTGAATTGGCAGAGCCGTTCACAAGATC Mus musculus solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 (Slc1a1), mRNA. XM_001002173 XM_001002184 XM_001002198 XM_001002207 integral to membrane [goid 16021] [evidence IEA]; integral to plasma membrane [goid 5887] [evidence IEA]; membrane [goid 16020] [evidence IEA] transport [goid 6810] [evidence IEA]; dicarboxylic acid transport [goid 6835] [evidence IEA] symporter activity [goid 15293] [evidence IEA]; sodium:dicarboxylate symporter activity [goid 17153] [evidence IEA]; carrier activity [goid 5386] [evidence IEA]; glutamate:sodium symporter activity [goid 15501] [evidence IDA] EAAC1; D130048G10Rik; MEAAC1; EAAC2; EAAT3 scl0020510.2_224-S-1
ILMN_1231752 Mus musculus RefSeq NM_177450.2 ILMN_217309 CNDP1 NM_177450.2 NM_177450.2 338403 31343343 NM_177450.2 Cndp1 NP_803233.1 5130142 NM_177450.2 S 2489 GCTCAATGAGTTTATCTGAATTGCTTAAGGCTTTTAACAGCGCCAGCATC 18 - 84744981-84745030 Mus musculus carnosine dipeptidase 1 (metallopeptidase M20 family) (Cndp1), mRNA. cytosol [goid 5829] [evidence ISS] hydrolase activity [goid 16787] [evidence IEA]; dipeptidase activity [goid 16805] [evidence ISS]; protein dimerization activity [goid 46983] [evidence IEA]; metallopeptidase activity [goid 8237] [evidence IEA]; carboxypeptidase activity [goid 4180] [evidence IEA] AI746433; Cn1 scl51187.13.1_39-S-1
ILMN_1257702 Mus musculus RefSeq scl51469.24.1_0 ILMN_234717 LARS NM_134137.2 NM_134137.2 107045 120537240 NM_134137.2 Lars NP_598898.2 106450465 NM_134137.2 S 3664 GGGATGGTTTTCGGATACTTCTGCTCCGAGAATCTCAAGCTGGCTCTAAC Mus musculus leucyl-tRNA synthetase (Lars), mRNA. XM_901187 XM_913429 XM_922755 XM_922767 XM_922771 XM_922775 XM_922782 XM_922785 XM_989215 cytoplasm [goid 5737] [evidence IEA] protein biosynthesis [goid 6412] [evidence IEA]; tRNA aminoacylation for protein translation [goid 6418] [evidence IEA]; cysteinyl-tRNA aminoacylation [goid 6423] [evidence IEA] cysteine-tRNA ligase activity [goid 4817] [evidence IEA]; ligase activity [goid 16874] [evidence IEA]; nucleotide binding [goid 166] [evidence IEA]; ATP binding [goid 5524] [evidence IEA]; leucine-tRNA ligase activity [goid 4823] [evidence IEA] 2310045K21Rik; 3110009L02Rik; AW536573; mKIAA1352 scl51469.24.1_0-S-1
ILMN_1251148 Mus musculus RefSeq scl0067230.1_121 ILMN_215300 ZFP329 NM_026046.2 NM_026046.2 67230 71037392 NM_026046.2 Zfp329 NP_080322.2 1410411 NM_026046.2 S 5339 GGCAATTACATGTGTGATATGTAAGGGGTATGATGTCATGCAACAAGAGG 7 - 11706499-11706548 Mus musculus zinc finger protein 329 (Zfp329), mRNA. nucleus [goid 5634] [evidence IEA]; intracellular [goid 5622] [evidence IEA] zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; nucleic acid binding [goid 3676] [evidence IEA] 2810439M05Rik; 4632409L22Rik; ZNF329 scl0067230.1_121-S-1
ILMN_2691286 Mus musculus RefSeq scl0067230.1_121 ILMN_215300 ZFP329 NM_026046.2 NM_026046.2 67230 71037392 NM_026046.2 Zfp329 NP_080322.2 730433 NM_026046.2 S 1703 CTTGAGTGAACAAAGGATTTGTTTTCAGATGTGACTTCCCTTGCTCGCAG 7 - 11710135-11710184 Mus musculus zinc finger protein 329 (Zfp329), mRNA. nucleus [goid 5634] [evidence IEA]; intracellular [goid 5622] [evidence IEA] zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; nucleic acid binding [goid 3676] [evidence IEA] 2810439M05Rik; 4632409L22Rik; ZNF329 scl067230.1_1-S-9
ILMN_1213242 Mus musculus RefSeq XM_205594.3 ILMN_198359 LOC277902 XM_205594.3 XM_205594.3 38084269 XM_205594.3 LOC277902 100610048 XM_205594.3 S 139 GTGACGGTGACAGTGGCAGATTCTAACGGGGAGAGGGTGGGCACGGAAAT GI_38084269-S-1
ILMN_2728484 Mus musculus MEEBO scl0077114.1_105 ILMN_220912 6030426L16RIK scl0077114.1_105 NM_183121.1 34147124 NM_183121.1 6030426L16Rik 2480711 NM_183121.1 S 590 GAAAAAATGAAAGGTTTAATCTTCCAATGCCAGTTGCCATGGGCAAGCCA scl0077114.1_105-S-2
ILMN_2748584 Mus musculus RefSeq scl41352.8_186 ILMN_222369 DULLARD NM_026017.2 NM_026017.2 67181 118129887 NM_026017.2 Dullard NP_080293.1 130180 NM_026017.2 S 1265 GGAAATGCCAGACTGGGACAGGCGAAGGCCTAGAGGAGCCGAAACAGTCT Mus musculus Dullard homolog (Xenopus laevis) (Dullard), mRNA. molecular_function [goid 3674] [evidence ND ]; phosphoric monoester hydrolase activity [goid 16791] [evidence IEA] 2610507E10Rik scl41352.8_186-S-6
ILMN_2519069 Mus musculus MEEBO scl21919.2_525 ILMN_195825 4930537H20RIK scl21919.2_525 4930537H20Rik 102360546 4930537H20Rik S 18 CACAGTGAGGATACAGCTTCCCACCCCACCCTATTGCACTAGCTAAGTCA scl21919.2_525-S-6
ILMN_1213815 Mus musculus Riken ri|C230092K21|PX00177D07|AK082709|4784 ILMN_206927 MTAP6 ri|C230092K21|PX00177D07|AK082709|4784 AK082709 Mtap6 100630551 AK082709 S 4393 GCCCGCCCCTCAGATGCGACGACTCACTTCAAATGTTGGTCTGTGCCTTT ri|C230092K21|PX00177D07|AK082709|4784-S-1
ILMN_1237075 Mus musculus RefSeq NM_145615.2 ILMN_214618 ETFA NM_145615.2 NM_145615.2 110842 31981825 NM_145615.2 Etfa NP_663590.2 5690040 NM_145615.2 S 1062 TCGTGGCTATTAACAAAGATCCAGAAGCTCCAATTTTCCAGGTGGCAGAT 9 - 55259782-55259831 Mus musculus electron transferring flavoprotein, alpha polypeptide (Etfa), nuclear gene encoding mitochondrial protein, mRNA. mitochondrion [goid 5739] [evidence IDA]; electron transfer flavoprotein complex (sensu Eukaryota) [goid 17133] [evidence TAS] transport [goid 6810] [evidence IEA] electron carrier activity [goid 9055] [evidence TAS]; FAD binding [goid 50660] [evidence IEA] D9Ertd394e; 2010200I21Rik scl0110842.2_3-S-1
ILMN_2649966 Mus musculus RefSeq NM_145615.2 ILMN_214618 ETFA NM_145615.2 NM_145615.2 110842 31981825 NM_145615.2 Etfa NP_663590.2 50347 NM_145615.2 S 905 GCAGTTGGTGCTTCCCGAGCTGCTGTTGATGCTGGCTTTGTTCCCAATGA 9 - 55280445-55280492:55283407-55283408 Mus musculus electron transferring flavoprotein, alpha polypeptide (Etfa), nuclear gene encoding mitochondrial protein, mRNA. mitochondrion [goid 5739] [evidence IDA]; electron transfer flavoprotein complex (sensu Eukaryota) [goid 17133] [evidence TAS] transport [goid 6810] [evidence IEA] electron carrier activity [goid 9055] [evidence TAS]; FAD binding [goid 50660] [evidence IEA] D9Ertd394e; 2010200I21Rik scl00110842.1_108-S-2
ILMN_2699167 Mus musculus RefSeq NM_145615.2 ILMN_214618 ETFA NM_145615.2 NM_145615.2 110842 31981825 NM_145615.2 Etfa NP_663590.2 6370044 NM_145615.2 S 264 ATGATTCCCTAGCACCCATTACTCTAAATACTATCACTGCAGCTGGACGT 9 - 55298201-55298250 Mus musculus electron transferring flavoprotein, alpha polypeptide (Etfa), nuclear gene encoding mitochondrial protein, mRNA. mitochondrion [goid 5739] [evidence IDA]; electron transfer flavoprotein complex (sensu Eukaryota) [goid 17133] [evidence TAS] transport [goid 6810] [evidence IEA] electron carrier activity [goid 9055] [evidence TAS]; FAD binding [goid 50660] [evidence IEA] D9Ertd394e; 2010200I21Rik scl0003604.1_30-S-3
ILMN_2586958 Mus musculus Riken ri|9530095N04|PX00654M15|AK079300|940 ILMN_207351 9530095N04RIK ri|9530095N04|PX00654M15|AK079300|940 AK079300 9530095N04Rik 102230390 AK079300 S 846 GGTTGACCCACAAAGTGGAAGGAGAGAACTGACCTCTGACCTCCGTGTGT ri|9530095N04|PX00654M15|AK079300|940-S-2
ILMN_2760075 Mus musculus MEEBO scl0029808.1_271 ILMN_223159 MGA scl0029808.1_271 NM_013720.1 7305248 NM_013720.1 Mga 6900064 NM_013720.1 S 8910 TTAACAGGAAGTGACCAGGAAGGCCGGGGGAGCAAGGTGATGCCTACATT scl0029808.1_271-S-7
ILMN_1255729 Mus musculus RefSeq scl018160.1_34 ILMN_222208 NPR1 NM_008727.5 NM_008727.5 18160 113930717 NM_008727.5 Npr1 NP_032753.5 3840040 NM_008727.5 S 3700 GGGACTGGAGGGGGACTCCTAAGTTTATAGGGCTGACTGAAATACCCAGT Mus musculus natriuretic peptide receptor 1 (Npr1), mRNA. integral to membrane [goid 16021] [evidence IEA]; membrane [goid 16020] [evidence IEA] intracellular signaling cascade [goid 7242] [evidence IEA]; cGMP biosynthesis [goid 6182] [evidence IEA]; cyclic nucleotide biosynthesis [goid 9190] [evidence IEA]; protein amino acid phosphorylation [goid 6468] [evidence IEA] phosphorus-oxygen lyase activity [goid 16849] [evidence IEA]; lyase activity [goid 16829] [evidence IEA]; guanylate cyclase activity [goid 4383] [evidence IMP]; peptide receptor activity, G-protein coupled [goid 8528] [evidence IEA]; ATP binding [goid 5524] [evidence IEA]; receptor activity [goid 4872] [evidence IEA]; protein kinase activity [goid 4672] [evidence IEA] Pndr; AI893888; GC-A; NPR-A; MGC117511; NPRA scl018160.1_34-S-1

Total number of rows: 46632

Table truncated, full table size 20426 Kbytes.

Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6105_Illumina_MouseWG-6_V1_1_R1_11234304_A.bgx.gz 5.2 Mb (ftp)(http) BGX

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap