NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6102 Query DataSets for GPL6102
Status Public on Dec 13, 2007
Title Illumina human-6 v2.0 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description Researchers can generate whole genome expression profiles for multiple samples on a single BeadChip. Researchers can profile six or eight samples perBeadChip, with more than 48,000 transcript probes per sample using the Human-6 v2 beadchip.

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://www.ncbi.nlm.nih.gov/projects/geo/info/spreadsheet.html
 
Submission date Nov 08, 2007
Last update date Feb 15, 2013
Organization Illumina Inc.
E-mail expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (4366) GSM254828, GSM254829, GSM254830, GSM254835, GSM254837, GSM254839 
Series (120)
GSE10080 IL-23 100ng/ml Treatment of CD3 CD28 Stimulated PBMCs
GSE10241 A Global Genomic View of MIF Knockdown Cell
GSE10842 Tumor Liver vs Normal Liver: ChIP-chip and RNA expression
Relations
Alternative to GPL6106
Alternative to GPL6370
Alternative to GPL6790
Alternative to GPL7363
Alternative to GPL5799
Alternative to GPL7180

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
Species
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Unigene_ID Unigene id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome build 36 version 3
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq
GB_ACC

Data table
ID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Unigene_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Array_Address_Id Probe_Type Probe_Start SEQUENCE Chromosome Probe_Chr_Orientation Probe_Coordinates Definition Ontology_Component Ontology_Process Ontology_Function Synonyms GB_ACC
ILMN_1725881 Homo sapiens RefSeq ILMN_44919 ILMN_44919 LOC23117 XM_933824.1 XM_933824.1 23117 89040007 XM_933824.1 LOC23117 XP_938917.1 2000349 I 122 GGCTCCTCTTTGGGCTCCTACTGGAATTTATCAGCCATCAGTGCATCTCT 16 - 21766363-21766363:21769901-21769949 PREDICTED: Homo sapiens KIAA0220-like protein, transcript variant 11 (LOC23117), mRNA. XM_933824.1
ILMN_1910180 Homo sapiens Unigene ILMN_127219 ILMN_127219 HS.575038 Hs.575038 Hs.575038 10437021 AK024680 2100682 S 1409 ACACCTTCAGGAGGGAAGCCCTTATTTCTGGGTTGAACTCCCCTTCCATG Homo sapiens cDNA: FLJ21027 fis, clone CAE07110 AK024680
ILMN_1804174 Homo sapiens RefSeq ILMN_139282 ILMN_139282 FCGR2B XM_938851.1 XM_938851.1 2213 88952550 XM_938851.1 FCGR2B XP_943944.1 1500347 I 1643 TAGGGGCAATAGGCTATACGCTACAGCCTAGGTGTGTAGTAGGCCACACC PREDICTED: Homo sapiens Fc fragment of IgG, low affinity IIb, receptor (CD32) (FCGR2B), mRNA. XM_938851.1
ILMN_1810835 Homo sapiens RefSeq ILMN_10478 ILMN_175835 SPRR3 NM_005416.1 NM_005416.1 6707 4885606 NM_005416.1 SPRR3 NP_005407.1 2640692 S 683 GAAGCCAACCACCAGATGCTGGACACCCTCTTCCCATCTGTTTCTGTGTC 1 + 151242655-151242704 Homo sapiens small proline-rich protein 3 (SPRR3), mRNA. cornified envelope [goid 1533] [pmid 15232223] [evidence TAS] keratinocyte differentiation [goid 30216] [pmid 8325635] [evidence NAS]; wound healing [goid 42060] [pmid 10510474] [evidence TAS]; epidermis development [goid 8544] [pmid 8325635] [evidence NAS]; keratinization [goid 31424] [evidence IEA] structural molecule activity [goid 5198] [pmid 15232223] [evidence TAS]; protein binding [goid 5515] [pmid 10510474] [evidence IPI] NM_005416.1
ILMN_1758197 Homo sapiens RefSeq ILMN_38756 ILMN_38756 LOC653895 XM_936379.1 XM_936379.1 653895 89033487 XM_936379.1 LOC653895 XP_941472.1 1440273 S 26 TAGCAGGGAGCGGTGAGGGAGAGCGGCTGGATTTCTTGCGGGATCTGCAC PREDICTED: Homo sapiens similar to protein geranylgeranyltransferase type I, beta subunit (LOC653895), mRNA. XM_936379.1
ILMN_1668162 Homo sapiens RefSeq ILMN_7652 ILMN_7652 DGAT2L3 NM_001013579.1 NM_001013579.1 158833 61888901 NM_001013579.1 DGAT2L3 NP_001013597.1 6480482 S 782 GTCAAGGCTCCACTGGGCTCCTGCCATACTCCAGGCCTATTGTCACTGTG X + 69376459-69376508 Homo sapiens diacylglycerol O-acyltransferase 2-like 3 (DGAT2L3), mRNA. membrane [goid 16020] [evidence IEA]; integral to membrane [goid 16021] [evidence IEA]; endoplasmic reticulum [goid 5783] [evidence IEA] lipid biosynthesis [goid 8610] [evidence IEA]; lipid metabolism [goid 6629] [evidence IEA] acyltransferase activity [goid 8415] [evidence IEA]; transferase activity [goid 16740] [evidence IEA] AWAT1; DGA2 NM_001013579.1
ILMN_1715600 Homo sapiens RefSeq ILMN_35097 ILMN_35097 LOC387701 XM_373469.3 XM_373469.3 387701 89031576 XM_373469.3 LOC387701 XP_373469.1 2350164 A 301 GTCCCCAACCCTAACCCGGACCTGGCACATACAAGACATTCAGCAGATGG 10 + 92811754-92811767:92811768-92811803 PREDICTED: Homo sapiens hypothetical LOC387701 (LOC387701), mRNA. XM_373469.3
ILMN_1912287 Homo sapiens Unigene ILMN_77451 ILMN_77451 HS.133181 Hs.133181 Hs.133181 27826545 BX093329 4890754 S 324 GTGCCAGCTGCCATTGCACTGCCTCACATTTTCCTTTAGATGTTTGAGCA BX093329 Soares_parathyroid_tumor_NbHPA Homo sapiens cDNA clone IMAGp998A124183 ; IMAGE:1648403, mRNA sequence BX093329
ILMN_1889125 Homo sapiens Unigene ILMN_108888 ILMN_108888 HS.545755 Hs.545755 Hs.545755 1999235 AA346998 5420445 S 139 CTGGAAAAGCAAAATTTGGATTTGTGGTTCAATCCACCATCTTTACTCAG EST53225 Fetal heart II Homo sapiens cDNA 3 end, mRNA sequence AA346998
ILMN_1682799 Homo sapiens RefSeq ILMN_1387 ILMN_1387 STAMBPL1 NM_020799.2 NM_020799.2 57559 52694663 NM_020799.2 STAMBPL1 NP_065850.1 7160255 S 1746 TGTAAGCACCGTCAACATCAGACACCTACTCATGGACATGTGGTTGCCGG 10 + 90672973-90673022 Homo sapiens STAM binding protein-like 1 (STAMBPL1), mRNA. ubiquitin cycle [goid 6512] [evidence IEA] zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; metallopeptidase activity [goid 8237] [evidence IEA]; ubiquitin thiolesterase activity [goid 4221] [evidence IEA] bA399O19.2; AMSH-LP; ALMalpha; KIAA1373; FLJ31524; AMSH-FP NM_020799.2
ILMN_1909767 Homo sapiens Unigene ILMN_104330 ILMN_104330 HS.539137 Hs.539137 Hs.539137 6568782 AW236393 4150719 S 239 ACCGCAGAGCCTTTGACCTCGGTACCTCAATATGAAGATTCAGGGTCTTC xo15e10.x1 NCI_CGAP_Ut2 Homo sapiens cDNA clone IMAGE:2704074 3, mRNA sequence AW236393
ILMN_1840770 Homo sapiens Unigene ILMN_88273 ILMN_88273 HS.372465 Hs.372465 Hs.372465 22919294 BU568994 1010360 S 693 TAATCAGGACCCAGCAAATTTCCCCGAAGCAATGGGGTCCCGGTGGGCTC AGENCOURT_10400114 NIH_MGC_82 Homo sapiens cDNA clone IMAGE:6616301 5, mRNA sequence BU568994
ILMN_1906209 Homo sapiens Unigene ILMN_108918 ILMN_108918 HS.545796 Hs.545796 Hs.545796 6834513 AW337887 1740255 S 39 GAAAGAGATTTTGGTAGGAGAGGGCTGAGGCTGACAGCGGGGAGATGCCA he12d07.x1 NCI_CGAP_CML1 Homo sapiens cDNA clone IMAGE:2918797 3, mRNA sequence AW337887
ILMN_1665311 Homo sapiens RefSeq ILMN_1785 ILMN_1785 STH NM_001007532.1 NM_001007532.1 246744 56090268 NM_001007532.1 STH NP_001007533.1 1050195 S 97 CAGCCTCTGTGTGAGTGGATGATTCAGGTTGCCAGAGACAGAACCCTCAG 17 + 41432579-41432628 Homo sapiens saitohin (STH), mRNA. MGC163193; MGC163191 NM_001007532.1
ILMN_1657235 Homo sapiens RefSeq ILMN_36381 ILMN_178946 LOC342979 XM_292820.6 XM_292820.6 342979 113428124 XM_292820.6 LOC342979 XP_292820.6 5220204 A 1452 CCACCGAGGGTGAAGAGGCAAGTGGCCCTAAGCAAAAGACGTGCCAGTGT 19 - 14025431-14025480 PREDICTED: Homo sapiens hypothetical LOC342979 (LOC342979), mRNA. XM_292820.6
ILMN_1655444 Homo sapiens RefSeq ILMN_34624 ILMN_171312 LOC728492 XM_001130874.1 XM_001130874.1 728492 113416615 XM_001130874.1 LOC728492 XP_001130874.1 1740192 I 397 GATGACTGGCTATTTGGAAAACCTGGGTGCTACTGCCAACTGGGTGTATC 5 + 70239388-70239389:70239390-70239437 PREDICTED: Homo sapiens similar to small EDRK-rich factor 1A, telomeric, transcript variant 4 (LOC728492), mRNA. XM_001130874.1
ILMN_1711453 Homo sapiens RefSeq ILMN_24114 ILMN_24114 CLEC12A NM_201625.1 NM_201625.1 160364 42490743 NM_201625.1 CLEC12A NP_963919.1 4210615 I 481 GCCCACAAGGAGGACTTACAATGTGGAACTTAGTCTCTTTCCCTCACTCC 12 + 10023039-10023088 Homo sapiens C-type lectin domain family 12, member A (CLEC12A), transcript variant 3, mRNA. sugar binding [goid 5529] [evidence IEA]; receptor activity [goid 4872] [evidence IEA] CLL1; MICL; CLL-1; DCAL-2; MGC70602 NM_201625.1
ILMN_1816369 Homo sapiens Unigene ILMN_77735 ILMN_77735 HS.136401 Hs.136401 Hs.136401 2269251 AA527182 6420553 S 473 AAGGTCAAGGGAGGCCGAAGGAGTGTGTCTTCCCCAGCTTTGTTGAGGCC ni20c01.s1 NCI_CGAP_Co4 Homo sapiens cDNA clone IMAGE:968544 3, mRNA sequence AA527182
ILMN_1656744 Homo sapiens RefSeq ILMN_33919 ILMN_33919 LOC648054 XM_937104.1 XM_937104.1 648054 89028492 XM_937104.1 LOC648054 XP_942197.1 7200546 S 1048 GACATCACTCGGTCTGTGACTTCGGTGCAATCTCCTTCAGGGAAGCCGGG PREDICTED: Homo sapiens hypothetical protein LOC648054 (LOC648054), mRNA. XM_937104.1
ILMN_1761911 Homo sapiens RefSeq ILMN_18324 ILMN_18324 SCYL1BP1 NM_152281.1 NM_152281.1 92344 22748638 NM_152281.1 SCYL1BP1 NP_689494.1 3930743 S 1385 TCTAGGGGTATGTTTCACCTTGATTTTGGCCCGGTTCTTTCAGTGTTCCG 1 + 168788407-168788456 Homo sapiens SCY1-like 1 binding protein 1 (SCYL1BP1), mRNA. cytoplasm [goid 5737] [pmid 12783284] [evidence ISS] protein binding [goid 5515] [pmid 15781263] [evidence IPI] NTKL-BP1; MGC51263; NTKLBP1; FLJ11752; MGC70512; RP11-545I10.1 NM_152281.1

Total number of rows: 48702

Table truncated, full table size 21016 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6102_Illumina_HumanWG-6_V2_0_R1_11223189_A.bgx.gz 5.8 Mb (ftp)(http) BGX

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap