NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL5359 Query DataSets for GPL5359
Status Public on Jan 05, 2008
Title Homo sapiens 1.2 K allele specific expression 2
Technology type oligonucleotide beads
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Illumina, Inc.
Manufacture protocol See Supplementary file
 
 
Submission date Jun 06, 2007
Last update date Jan 05, 2008
Contact name Aik Choon Tan
E-mail actan@jhu.edu
Phone 410-502-8743
Fax 410-614-9006
Organization name Johns Hopkins University
Department The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins
Street address 1650 Orleans Street, RM 1M86
City Baltimore
State/province MD
ZIP/Postal code 21231
Country USA
 
Samples (516) GSM200062, GSM200063, GSM200064, GSM200065, GSM200066, GSM200067 
Series (2)
GSE8055 Allele-Specific Expression 2
GSE9596 Allele-specific expression in familial pancreatic cancer

Data table header descriptions
ID
GENE Gene Symbol
ASO1 Allele Specific Oligonucleotide 1
ASO2 Allele Specific Oligonucleotide 2
LSO Ligation Specific Oligonucleotide
CLONE_ID

Data table
ID GENE ASO1 ASO2 LSO CLONE_ID
rs8073904 AATK CAGTGAGGATGAGGACACGGCT CAGTGAGGATGAGGACACGGCC CATCTTCACCGACACGTC rs8073904
rs1056169 ABL1 GGGACCAGCCGTCTTCCACT GGGACCAGCCGTCTTCCACC CCTTCATCCCTCTCATATCAAC rs1056169
rs1056174 ABL1 CGGGCTCGCCCATACCCA CGGGCTCGCCCATACCCG GGACTAGTGAGTCAGCACCTT rs1056174
rs1064152 ABL1 CCGCAATGCCGCTGAGTATCT CCGCAATGCCGCTGAGTATCC GATCAATGGCAGCTTCTTG rs1064152
rs1064156 ABL1 CTGCTAGAGAAGGACTACCGCATGA CTGCTAGAGAAGGACTACCGCATGG CAGAGAAGGTCTATGAACTCATG rs1064156
rs2229068 ABL1 CCGGAGCGCAGAGGGGCT CCGGAGCGCAGAGGGGCC GAAGAGGGCCGAGACATC rs2229068
rs2229070 ABL1 GCACAGTAACGCCTCCCCCG GCACAGTAACGCCTCCCCCC GGCTGGTGAAAAAGAATGAG rs2229070
rs7457 ABL1 GGTACTGGTCCCTTCCTTTTGTTAAT GGTACTGGTCCCTTCCTTTTGTTAAC TGATGTGCCACTATATTTTACAC rs7457
rs1318056 ABL2 GGGACAGTTCTCCTTCCACCTAATAC GGGACAGTTCTCCTTCCACCTAATAG TATGGCAGAGATCAGGACACT rs1318056
rs2274230 ABL2 TGACCTGTCTCAGGTCTATGACCTACTA TGACCTGTCTCAGGTCTATGACCTACTC AAAAAGGATATCGAATGGAACA rs2274230
rs10206004 ACVR1 CCGTCCCCTGGCCAAGCT CCGTCCCCTGGCCAAGCC ACTGGTGTAACAGGAACATCAC rs10206004
rs1134723 ACVR1 AAAGGCAGGTATGGTGAGGTGTGA AAAGGCAGGTATGGTGAGGTGTGG AATGTTGCCGTGAAGATCTT rs1134723
rs1146031 ACVR1 GGCAGCTGGCAAGGGGAA GGCAGCTGGCAAGGGGAG ATGTTGCCGTGAAGATCTTCT rs1146031
rs2228947 ACVR1 CAGCAGTGCTTTTCCTCACTGAGT CAGCAGTGCTTTTCCTCACTGAGC CTTCCACGTCTACCAGAAAG rs2228947
rs6729964 ACVR1 GACTATCTTCAGCTTACTACTCTGGATACA GACTATCTTCAGCTTACTACTCTGGATACG TTAGCTGCCTTCGAATAGTG rs6729964
rs11169974 ACVR1B CCCTGCTGACCTCCCACCTATT CCCTGCTGACCTCCCACCTATC CGGTTTATAGGTAATGATGGAAC rs11169974
rs11831802 ACVR1B GGGATCTGCCAACACACGTCT GGGATCTGCCAACACACGTCC CTCCCAAGCCACTAGCC rs11831802
rs2641516 ACVR1B TGTGCTGATATTTATGCCCTCGGG TGTGCTGATATTTATGCCCTCGGC TTGTATATTGGGAGATTGCTC rs2641516
rs2641529 ACVR1B CTGCCCAGCCCTCTGTGGA CTGCCCAGCCCTCTGTGGC CAAGAGGGACAGAGCCC rs2641529
rs2714 ACVR1B GGCTGTGGGTGGTGATTTGGTA GGCTGTGGGTGGTGATTTGGTC AACTTTGAAGCCATAACTTTTAAC rs2714

Total number of rows: 1189

Table truncated, full table size 112 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap