NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL5358 Query DataSets for GPL5358
Status Public on Jan 05, 2008
Title Homo sapiens 0.9 K allele specific expression 1
Technology type oligonucleotide beads
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Illumina, Inc.
Manufacture protocol See Supplementary file
 
 
Submission date Jun 06, 2007
Last update date Feb 19, 2008
Contact name Aik Choon Tan
E-mail actan@jhu.edu
Phone 410-502-8743
Fax 410-614-9006
Organization name Johns Hopkins University
Department The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins
Street address 1650 Orleans Street, RM 1M86
City Baltimore
State/province MD
ZIP/Postal code 21231
Country USA
 
Samples (492) GSM199481, GSM199482, GSM199483, GSM199484, GSM199485, GSM199486 
Series (2)
GSE8054 Allele-Specific Expression 1
GSE9596 Allele-specific expression in familial pancreatic cancer

Data table header descriptions
ID
GENE Gene Symbol
ASO1 Allele Specific Oligonucleotide 1
ASO2 Allele Specific Oligonucleotide 2
LSO Ligation Specific Oligonucleotide
SNP_ID
SPOT_ID

Data table
ID GENE ASO1 ASO2 LSO SNP_ID SPOT_ID
rs1137170 ABCA1 AAACTAGACAAAAGTTTCACAACAGATTTT AAACTAGACAAAAGTTTCACAACAGATTTC AAGTTAAATCATTTTCATTAAAAGG rs1137170
rs1997618 ABCA1 GCCGAGTCAAGAAGTTAATGATGCCAT GCCGAGTCAAGAAGTTAATGATGCCAC AAACAAATGAAGAAACACCTAAAG rs1997618
rs2066718 ABCA1 GGTGTGTGGCATGGCAGGACTACA GGTGTGTGGCATGGCAGGACTACG GGGCTTCACACTCAAGATCT rs2066718
rs2230805 ABCA1 CAATGAAACCTTCTCTGGGTTCCTA CAATGAAACCTTCTCTGGGTTCCTG ATCACAACCTCTCTCTCCCA rs2230805
rs2230806 ABCA1 GTCTGAGCTTTGTGGCCTACCAAA GTCTGAGCTTTGTGGCCTACCAAG GAGAAACTGGCTGCAGCAG rs2230806
rs2246841 ABCA1 CATCCCGAGGGAGGGGGA CATCCCGAGGGAGGGGGG TGAAGATCAAGTCTCTCAACTG rs2246841
rs363717 ABCA1 TCATTACTAACTTCTTCCACTTTTTCCAA TCATTACTAACTTCTTCCACTTTTTCCAG ATTTGAATATTAACGCTAAAGGTG rs363717
rs4149312 ABCA1 TGGCTTCAATCTCACCACTTCGA TGGCTTCAATCTCACCACTTCGG CTCCATGATGCTGTTTGACAC rs4149312
rs4149341 ABCA1 GCACTGTGAACTATTTTGAAGAAAACACA GCACTGTGAACTATTTTGAAGAAAACACG CATTTTAATACAGATTGAAAGGAC rs4149341
rs4392957 ABCA1 GTGTGTTCCATGATCTGGAAGGCA GTGTGTTCCATGATCTGGAAGGCC GTGGGAGGAACTCAGCC rs4392957
rs1056209 ABL1 GGCCAGCAGCCTCGCACAA GGCCAGCAGCCTCGCACAG CCCTAGCTTTACGCTCATCAC rs1056209
rs1064153 ABL1 GGCGTGAGAGTGAGAGCAGTCCTA GGCGTGAGAGTGAGAGCAGTCCTG CCAGAGGTCCATCTCGCT rs1064153
rs1064167 ABL1 GCCATACCCATGACAGTGGCTGAG GCCATACCCATGACAGTGGCTGAC AGGGACTAGTGAGTCAGCAC rs1064167
rs2229069 ABL1 ACAAGTGGGAGATGGAACGCACA ACAAGTGGGAGATGGAACGCACG ACATCACCATGAAGCACAAG rs2229069
rs1050146 ACTG2 GCCCAGCTCACTCAGCCACAT GCCCAGCTCACTCAGCCACAC CACCATGTGTGAAGAGGAGAC rs1050146
rs1006567 ADCYAP1 GAGAGCCTGAGGTGGTAGGAGGAC GAGAGCCTGAGGTGGTAGGAGGAG ACCCTGGAAATGGACTGGT rs1006567
rs2231190 ADCYAP1 TCGTTTTCCAAACTGACTCAACAGTT TCGTTTTCCAAACTGACTCAACAGTC TCGCTCGTGTGTTCTATCC rs2231190
rs1130443 AKT1 AAAGCCCTCCCCCTTCCCCTTT AAAGCCCTCCCCCTTCCCCTTC GTGTCACAGTTCTTGGTGACT rs1130443
rs2670861 AOC3 GGGGTCCAGCTCCCCCTCTA GGGGTCCAGCTCCCCCTCTG AGTTCTATCCCCAAGGCC rs2670861
rs9563 AOC3 GTTGTGTTTCAGAAAGGAGTAGAATATAAAT GTTGTGTTTCAGAAAGGAGTAGAATATAAAC CATAATTGCTTATGTATGCCTATT rs9563

Total number of rows: 928

Table truncated, full table size 89 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap