NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL4718 Query DataSets for GPL4718
Status Public on Jan 06, 2007
Title IPMC - microRNA v5LNA
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Homo sapiens
Manufacturer IPMC
Manufacture protocol Spotted microarray
Support glass
Coating aminosilane
 
 
Web link http://www.microarray.fr
Contributor(s) Le Brigand K, Barbry P, Mari B
Submission date Jan 03, 2007
Last update date Jan 06, 2007
Contact name Kevin Lebrigand
Organization name IPMC/CNRS
Lab Functional Genomics Platform of Nice-Sophia-Antipolis, France.
Street address 660 route des lucioles
City Valbonne - Sophia-Antipolis
ZIP/Postal code 06560
Country France
 
Samples (26) GSM464289, GSM464290, GSM464291, GSM464292, GSM464293, GSM464294 
Series (2)
GSE18692 MiRNA and lung cancer (INCA project) - 40 miRNAs microarrays
GSE18805 Role of miR-210 in late stages of lung cancer: mitochondrial alterations associated with a modulation of HIF1 activity

Data table header descriptions
ID
BLOCK Block
COLUMN Column
ROW Row
INTERNAL_ID Mediante Adhoc oligo id
ACCESSION Mir references
SANGER_ID Sanger ID
SANGER_REF Sanger REF
CLONE_ID
SPOT_ID
SEQUENCE Sequence

Data table
ID BLOCK COLUMN ROW INTERNAL_ID ACCESSION SANGER_ID SANGER_REF CLONE_ID SPOT_ID SEQUENCE
1 1 1 1 adhoc-13973 GAU-145 - - CGTTTATCTGTCATGGCC
2 1 2 1 adhoc-13973 GAU-145 - - CGTTTATCTGTCATGGCC
3 1 3 1 adhoc-13949 GAU-121 - - ATTGAGAAGATGCTTGGAGA
4 1 4 1 adhoc-13949 GAU-121 - - ATTGAGAAGATGCTTGGAGA
5 1 5 1 adhoc-13925 GAU-97 - - GTGTGAAAGCGCCAGCATTT
6 1 6 1 adhoc-13925 GAU-97 - - GTGTGAAAGCGCCAGCATTT
7 1 7 1 adhoc-13902 GAU-78 - - TTAATTAGCAGCCTAATAAA
8 1 8 1 adhoc-13902 GAU-78 - - TTAATTAGCAGCCTAATAAA
9 1 9 1 adhoc-13971 GAU-143 - - GCCTCTCAGCCCTTGGCCAG
10 1 10 1 adhoc-13971 GAU-143 - - GCCTCTCAGCCCTTGGCCAG
11 1 11 1 adhoc-13947 GAU-119 - - CAACTAAGAAATTATGTAGA
12 1 12 1 adhoc-13947 GAU-119 - - CAACTAAGAAATTATGTAGA
13 1 13 1 adhoc-13923 GAU-95 - - TTCATTCACACTTAGTGGCA
14 1 14 1 adhoc-13923 GAU-95 - - TTCATTCACACTTAGTGGCA
15 1 15 1 adhoc-13901 Human_Glu2 - - Human_Glu2 ATTCCTGACCGGGAATCGAA
16 1 16 1 adhoc-13901 Human_Glu2 - - Human_Glu2 ATTCCTGACCGGGAATCGAA
17 1 1 2 adhoc-13977 GAU-149 - - TGTTGAGAATCCTATTTTTA
18 1 2 2 adhoc-13977 GAU-149 - - TGTTGAGAATCCTATTTTTA
19 1 3 2 adhoc-13953 GAU-125 - - CCCACCAGCTGCCTCCAAAG
20 1 4 2 adhoc-13953 GAU-125 - - CCCACCAGCTGCCTCCAAAG

Total number of rows: 12288

Table truncated, full table size 1221 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap