NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL4133 Query DataSets for GPL4133
Status Public on Aug 17, 2006
Title Agilent-014850 Whole Human Genome Microarray 4x44K G4112F (Feature Number version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
Catalog number G4112F
 
Description
This multi-pack (4X44K) formatted microarray represents a compiled view of the human genome as it is understood today. The sequence information used to design this product was derived from a broad survey of well known sources such as RefSeq, Goldenpath, Ensembl, Unigene and others. The resulting view of the human genome covers 41K unique genes and transcripts which have been verified and optimized by alignment to the human genome assembly and by Agilent's Empirical Validation process.

Arrays of this design have barcodes that begin with 16014850 or 2514850.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

*** A different version of this platform with the Agilent Probe names in the ID column is assigned accession number GPL6480.
 
Submission date Aug 17, 2006
Last update date Feb 22, 2018
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (14607) GSM187285, GSM187286, GSM187287, GSM187288, GSM187289, GSM187290 
Series (787)
GSE7701 Profiling of RWPE cells stably over-expressing ETV1
GSE7702 Comparison of the prostate cancer cell line LNCaP and its androgen insensitive derivative C4-2B
GSE7900 Gene expression in undifferentiated human ES cells - Agilent
Relations
Alternative to GPL6480
Alternative to GPL15285
Alternative to GPL16022

Data table header descriptions
ID Agilent feature number
COL Column
ROW Row
NAME NAME
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBankAccession
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence
SPOT_ID
ORDER

Data table
ID COL ROW NAME SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE SPOT_ID ORDER
1 266 170 GE_BrightCorner GE_BrightCorner pos 1
2 266 168 DarkCorner DarkCorner pos 2
3 266 166 DarkCorner DarkCorner pos 3
4 266 164 DarkCorner DarkCorner pos 4
5 266 162 DarkCorner DarkCorner pos 5
6 266 160 DarkCorner DarkCorner pos 6
7 266 158 DarkCorner DarkCorner pos 7
8 266 156 DarkCorner DarkCorner pos 8
9 266 154 DarkCorner DarkCorner pos 9
10 266 152 DarkCorner DarkCorner pos 10
11 266 150 DarkCorner DarkCorner pos 11
12 266 148 A_24_P66027 A_24_P66027 FALSE NM_004900 NM_004900 9582 APOBEC3B apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B Hs.226307 ENST00000407298 NP075413 ref|NM_004900|ref|NM_145699|ens|ENST00000407298|ens|ENST00000333467 chr22:37717484-37717543 hs|22q13.1 Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B), mRNA [NM_004900] GO:0003723(RNA binding)|GO:0005575(cellular_component)|GO:0008150(biological_process)|GO:0008270(zinc ion binding)|GO:0016787(hydrolase activity)|GO:0016814(hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines)|GO:0046872(metal ion binding) GCTGCCCGCATCTATGATTACGACCCCCTATATAAGGAGGCGCTGCAAATGCTGCGGGAT 12
13 266 146 A_32_P77178 A_32_P77178 FALSE AA085955 Hs.12341 gb|AA085955|gb|AL567297|gb|BF871687|gb|BM671900 chr1:152822085-152822144 hs|1q21.3 AA085955 zl83f11.s1 Stratagene colon (#937204) Homo sapiens cDNA clone IMAGE:511245 3', mRNA sequence [AA085955] GGTCAATTTTTGGTCAAAAGTACAGAGAGCATAGAATAAAAGCAAAGATGTGAATGTCTC 13
14 266 144 A_23_P212522 A_23_P212522 FALSE NM_014616 NM_014616 23200 ATP11B ATPase, class VI, type 11B Hs.478429 ENST00000323116 THC2580543 ref|NM_014616|ens|ENST00000323116|gb|AB023173|gb|AL133061 chr3:184121316-184121375 hs|3q26.33 Homo sapiens ATPase, class VI, type 11B (ATP11B), mRNA [NM_014616] GO:0000166(nucleotide binding)|GO:0000287(magnesium ion binding)|GO:0004012(phospholipid-translocating ATPase activity)|GO:0005524(ATP binding)|GO:0005637(nuclear inner membrane)|GO:0006754(ATP biosynthetic process)|GO:0006811(ion transport)|GO:0008152(metabolic process)|GO:0015075(ion transmembrane transporter activity)|GO:0015662(ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism)|GO:0015914(phospholipid transport)|GO:0015917(aminophospholipid transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016787(hydrolase activity)|GO:0016820(hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances) ATTTTCTAACTGTCCTCTTTCTTGGGTCTAAAGCTCATAATACACAAAGGCTTCCAGACC 14
15 266 142 A_24_P934473 A_24_P934473 FALSE AK092846 100132006 LOC100132006 hypothetical protein LOC100132006 Hs.593666 THC2483825 gb|AK092846|gb|AX747763|thc|THC2483825 chr16:8649039-8649098 hs|16p13.2 Homo sapiens cDNA FLJ35527 fis, clone SPLEN2001781. [AK092846] AAGCCAAGTACTTTAGAGAAGAAAAACGGTCTCAGCTGAACCTGTAGTGAGAGCATGCAG 15
16 266 140 A_24_P9671 A_24_P9671 FALSE NM_001539 NM_001539 3301 DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 Hs.445203 ENST00000330899 THC2482967 ref|NM_001539|gb|AY186741|ens|ENST00000330899|gb|BT007292 chr9:33026682-33027066 hs|9p13.3 Homo sapiens DnaJ (Hsp40) homolog, subfamily A, member 1 (DNAJA1), mRNA [NM_001539] GO:0005737(cytoplasm)|GO:0005856(cytoskeleton)|GO:0006457(protein folding)|GO:0006986(response to unfolded protein)|GO:0007283(spermatogenesis)|GO:0008270(zinc ion binding)|GO:0016020(membrane)|GO:0030317(sperm motility)|GO:0030521(androgen receptor signaling pathway)|GO:0031072(heat shock protein binding)|GO:0046872(metal ion binding)|GO:0050750(low-density lipoprotein receptor binding)|GO:0051082(unfolded protein binding) ATCCAGGTCAGATTGTCAAGCATGGAGATATCAAGTGTGTACTAAATGAAGGCATGCCAA 16
17 266 138 A_32_P29551 A_32_P29551 FALSE THC2741789 thc|THC2741789 chr16:6029254-6029313 hs|16p13.3 CCTCTGTCTGGCTTTCTGGATCCTTAGATGAATTGCAGTTGGATTGGAATTTGGCACAAA 17
18 266 136 A_24_P801451 A_24_P801451 FALSE NM_006709 NM_006709 10919 EHMT2 euchromatic histone-lysine N-methyltransferase 2 Hs.709218 ENST00000375537 THC2496448 ref|NM_006709|ref|NM_025256|gb|BC018718|ens|ENST00000375537 unmapped Homo sapiens euchromatic histone-lysine N-methyltransferase 2 (EHMT2), transcript variant NG36/G9a, mRNA [NM_006709] GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0000239(pachytene)|GO:0005515(protein binding)|GO:0005575(cellular_component)|GO:0005634(nucleus)|GO:0007130(synaptonemal complex assembly)|GO:0007286(spermatid development)|GO:0008150(biological_process)|GO:0008168(methyltransferase activity)|GO:0008270(zinc ion binding)|GO:0009566(fertilization)|GO:0016568(chromatin modification)|GO:0016740(transferase activity)|GO:0018024(histone-lysine N-methyltransferase activity)|GO:0035265(organ growth)|GO:0046872(metal ion binding)|GO:0051567(histone H3-K9 methylation) AAATCGGGCCATCCGCACCAGAGGAAGATCATTCTGCCGGGACGTGGCTCGGGGCTATGA 18
19 266 134 A_32_P30710 A_32_P30710 FALSE NM_000978 NM_000978 9349 RPL23 ribosomal protein L23 Hs.406300 ENST00000245857 THC2496402 ref|NM_000978|gb|BC034378|ens|ENST00000245857|ens|ENST00000378096 chr17:34260229-34260170 hs|17q12 Homo sapiens ribosomal protein L23 (RPL23), mRNA [NM_000978] GO:0003735(structural constituent of ribosome)|GO:0005622(intracellular)|GO:0005737(cytoplasm)|GO:0005829(cytosol)|GO:0005840(ribosome)|GO:0006412(translation)|GO:0006414(translational elongation)|GO:0006610(ribosomal protein import into nucleus) ACGAAAGTCATACCGTAGAAAAGATGGCGTGTTTCTTTATTTTGAAGATAATGCAGGAGT 19
20 266 132 A_32_P89523 A_32_P89523 FALSE T12590 Hs.568044 gb|T12590 chr9:129782208-129782267 hs|9q34.11 T12590 CHR90110 Chromosome 9 exon II Homo sapiens cDNA clone P94_55 5' and 3', mRNA sequence [T12590] GAATTTCTTCTTCTTCATCAAGAAAGCCATGAGCGAGTTCCCTGAGTCTGAAGCCCCGAA 20

Total number of rows: 45220

Table truncated, full table size 24305 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL4133_old_annotations.txt.gz 6.9 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap