This array was designed for copy-number assessments across the human genome. We printed 2,460 BAC and P1 clones in triplicate (approx. 7,500 elements) in a 12mm X 12mm square. Each clone contains at least one STS, allowing linkage to the genome sequence. Cytogenetic mapping indicated that 2,298 of the arrayed clones are single copy; this array thus provides average resolution of approximately 1.4 Mb across the genome.
Protocol from Nat Genet 2001 Nov;29(3):263-4 web supplement: <b>Genomic clones.</b> We selected the majority of the clones for the arrays from the set of cytogenetically mapped BACs reported previously4 and obtained these clones from the Roswell Park Cancer Institute. We obtained additional clones mapping near the telomeres of each chromosome5 and clones containing certain named genes from J. Flint, D. Ledbetter, C. Lese and Vysis, Inc. We included P1 clones used previously on arrays of chromosome 20 (ref. 1,2). We also used additional clones from the DuPont A library, including RMC01P052 (163D7), RMC01P057 (213C4), RMC07P014 (548H7), RMC07P025 (1128F4), RMC07P028 (252B4) and RMC07P038 (1429E1.c2), as well as RMC17P041 (75D7), RMC17P069 (88H6) and RMCXP002 (124A3) from the DuPont B library. The array provides only minimal coverage of the Y chromosome, since only one clone unique to the Y chromosome is included on the array in addition to the telomeric clones that are shared between the X and Y chromosomes. <b>Isolation of BAC/P1 DNA.</b> We inoculated 0.1l of a glycerol stock of BAC or P1 containing bacteria into 5 ml LB media containing chloramphenicol (10 g/ml) or kanamycin (50 g/ml) for BACs or P1s, respectively and incubated the cultures overnight (~16 h) at 37 C with agitation at 225 rpm. We prepared larger cultures for DNA isolation, by inoculating 25 mlLB media, containing the appropriate antibiotic with 200 l of the previously grown overnight culture and incubating in a shaking incubator at 37 C at 225 rpm overnight (~16 h). We monitored bacterial growth by measuring the OD of a 1:10 dilution, which preferably ranged between 0.25 and 0.35 at a wavelength of 600 nm. We used the Qiagen Plasmid Mini kit to isolate DNA, following a modified version of the Qiagen Plasmid Mini Purification protocol. We transferred the 25 ml cultures into 50 ml tubes and centrifuged them for 15 min at 4000 rcf at 4 C to pellet the bacteria. We re-suspended the pellet in Qiagen buffer P1 (1.5 ml), containing RNase A at the manufacturer's recommended concentration and then added buffer P2 (1.5 ml). We mixed the tubes extremely gently by inversion and incubated at room temperature for 5 min. Then, we added buffer P3 (1.5 ml), again mixed very gently by inversion and incubated on ice for 10 min. We inverted each tube once and centrifuged at 4000 rpm at 4 C until the supernatant became clear (45 to 60 min). We filtered the supernatant through a 35-micron nylon mesh prior to loading onto Qiagen-tip 20 columns, which had been equilibrated following the manufacturer's protocol. We followed the manufacturer's protocol for the DNA isolation steps with the exception that the elution buffer QF was heated to 65 C before it was added to the column. After elution, we added 0.56 ml isopropanol to the DNA and incubated overnight at 4 C. We collected the DNA pellet by centrifugation for 45 min at 14000 rpm at 4 C. After aspirating the supernatant, we allowed the pellet to dry in air for at most 30 min before re-suspending the DNA in 50 l of H2O. We determined the DNA concentration using a fluorometer. The yield typically ranged between 60-100 ng/l (i.e. 3-5 g per isolation). To ascertain DNA purity, we digested each BAC (200 ng) with HindIII and electrophoresed the digest through a 0.75% agarose gel. We discarded DNA preparations that showed a significant contamination with host bacterial DNA, seen as a background smear of degraded DNA in the gel. <b>Preparation of BAC/P1 DNA representations by ligation-mediated PCR.</b> We digested the DNA with MseI by incubating overnight at 37 C in a 5 l reaction containing 1.5 l DNA (20 to 600 ng), 0.4 U/l MseI (New England Biolabs), and 0.4x One-Phor-All-Buffer-Plus (Amersham). For ligation of adapters, we diluted 1 l of each digest to a final concentration of 1 ng/l with H2O and then mixed 1 ng of the digested DNA with 0.5 l One-Phor-All-Buffer-Plus (10x, Amersham), 0.5 l of 100 M Primer 1 (TAACTAGCATGC), 0.5 l of 100 M Primer 2 (5' aminolinker AGTGGGATTCCGCATGCTAGT) and 5.5 l H2O. We incubated the mixture at 65 C for 1 min after which we ramped the temperature down to 15 C with a ramp-speed of 1.3 C per minute. When the temperature reached 15 C, we added 1 l of 10 mM ATP and 1 l T4-DNA ligase (5 U/l, Gibco BRL) and continued incubation at 15 C overnight. To initiate the first round of PCR amplification, we added a 40 l mixture, consisting of 3 l PCR Buffer 1 (Expand Long Template PCR System, Roche), 2 l of a mixture of each nucleotide (10 mM) and 35 l H2O to the ligation reaction. Before we started the PCR program, we incubated the reaction at 68 C for 4 min and then added 1 l DNA polymerase (3.5 U/l, Expand Long Template PCR System, Roche). We carried out thermal cycling in a Perkin-Elmer Gene Amp PCR System 9700 block as follows: 94 C for 40 s, 57 C for 30 s, 68 C for 1.25 min for 14 cycles, followed by, 94 C for 40 s, 57 C for 30 s, 68 C for 1.75 min for 34 cycles and 94 C for 40 s, 57 C for 30 s and 68 C for 5 min for the final cycle. We electrophoresed 3.5 l of the PCR product through a 1% agarose gel to determine the size range of the amplified DNA, which ideally ranged from 100 to 2000 bp. To make the DNA for spotting on the arrays, we carried out a second round of amplification in a 100 l reaction containing 1 l of the primary PCR product, 4 M Primer 2, TAQ-buffer II (1x; Perkin Elmer), 0.2 mM dNTP mix, 5.5 mM MgCl2 (Perkin Elmer), 2.5 U Amplitaq Gold (Perkin Elmer) and H2O. We carried out an initial incubation at 95 C for 10 min in a MJ Research Peltier Thermal Cycler 225, followed by 95 C for 30 s, 50 C for 30 s and 72 C for 2 min for 45 cycles and finally 7 min at 72 C. This reaction yields ~10 g of DNA, with each fragment containing a 5' amino linker. <b>Preparation of DNA spotting solutions.</b> We evaporated the amplification reaction (100 l) to a final volume of 50 l by incubation at 45 C in a hybridization oven (Techne, Hybridizer HB-1D) for approximately 75 min and then added 2.5 volumes of ice-cold ethanol and 0.1 volumes of 3 M NaOAc to precipitate the DNA. (The use of ethanol precipitation proved superior to isopropanol precipitation.) We inverted the tubes and chilled them at 20 C for 15 min before collecting the precipitate by centrifugation at 1699 rcf for 90 min. We washed the pellets with 70% ethanol (150 l) and collected them by centrifugation at 1699 rcf for 45 min. We air-dried the pellets for approximately 60 to 90 min and then re-suspended them in 12 l of 20% DMSO in H2O (~0.8 g/l). We transferred the DNA solutions into 864 well microtitre plates for robotic arraying. Previously, we prepared DNA for spotting in 80% DMSO and 0.3 g/l nitrocellulose. However, we subsequently evaluated spotting solutions containing various concentrations of dimethyl formamide, formamide or DMSO, with or without nitrocellulose. We determined that nitrocellulose was not required for spotting DNA prepared by PCR using primers with 5'amino linkers and that spotting solutions made with 20% DMSO performed well. We have also generated representations of large insert clones for arraying by using degenerate oligonucleotide primed PCR and by amplification of mixtures of subclones from BACs, but found the ligation-mediated PCR procedure to be superior. <b>Array printing.</b> We used a custom built printer, employing a 4 x 4 array of quartz capillary tubes spaced on 3 mm centers to print ~70-100 µm diameter spots on 130 µm centers. We printed each DNA solution in triplicate to create an array of ~7500 elements in a 12 mm square area. We printed the arrays on chromium coated microscope slides (PTI or Nanofilm) for these studies, but also routinely print the arrays on glass slides (Corning GAPs). We allowed the printed slides to dry overnight, then exposed the slides to UV light (65 mJ) in a UV Stratalinker 2400 (Stratagene). We hybridized to these slides without additional treatment, except for the pre-hybridization slide blocking described below. We found no indication of DNA loss from the spots at any stage of the procedure when we performed hybridization in formamide buffers at 37 °C. Keywords = comparative genomic hybridization, CGH, array
Less...
More...