NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL2510 Query DataSets for GPL2510
Status Public on Jul 07, 2006
Title Rosetta/Merck (C57BL/6J X C3H/HeJ)F2 on ApoE null backgrounds 75K oligio array 1
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Mus musculus
Manufacturer Agilent
Manufacture protocol Agilent:HW:2520
 
Description Oligonucleotide array on glass. Contains 60mer probes designed against 23,000+ mouse genes arrayed on Agilent ink-jet arrays. Keywords=mouse genetics gene expression oligonucleotide
 
Web link http://www.mednet.ucla.edu
Contributor(s) Wang SS, Yehya N, Wang H, Schadt EE, Drake TA, Lusis AJ
Citation(s) 16462940
Submission date Jun 04, 2005
Last update date Jan 18, 2013
Contact name Leslie Ingram-drake
E-mail(s) lingram@mednet.ucla.edu
Phone 310-794-9036
Fax 310-794-7345
URL http://www.mednet.ucla.edu
Organization name UCLA
Department Medicine/MIMG/Human Genetics
Street address 47-123 CHS
City Los Angeles
State/province CA
ZIP/Postal code 90095-1359
Country USA
 
Samples (2429) GSM60323, GSM60324, GSM60325, GSM60326, GSM60327, GSM60328 
Series (14)
GSE2814 Expression profiling of liver tissue from (C57BL/6J X C3H/HeJ)F2 mice on ApoE null backgrounds
GSE3086 Expression profiling of Adipose tissue from (C57BL/6J X C3H/HeJ)F2 mice on ApoE null backgrounds
GSE3087 Expression profiling of brain tissue from (C57BL/6J X C3H/HeJ)F2 mice on ApoE null backgrounds

Data table header descriptions
ID Rosetta generated unique probe identifier
SEQUENCE_ID Identifier of sequence associated with the gene represented on the microarray
GB_ACC GenBank accession number associated with gene represented on the microarray;
PT_ACC
SPOT_ID
GENE_SYMBOL Gene symbol from LocusLink
SEQUENCE Sequence of oligonucleotide probe

Data table
ID SEQUENCE_ID GB_ACC PT_ACC SPOT_ID GENE_SYMBOL SEQUENCE
10024393144 AB024004 AB024004 Zfp53 CATTGCAACTATTGTGACATAGCATTTATTTGGTGTTCCCTGCTTAAAAATCACAACAGT
10024393145 CB446705 CB446705 0610012D14Rik CTCCCCTACTACCCTTACTGTCATATTGACAACTATGGGTCCCAGTAAACATCAGAGTTC
10024393146 NM_033444 NM_033444 Clic1 TTATTTTGGGATGGGGTGGGTAGGACAACGCATTTCAGTAATAAAATACAGAATGAAAAA
10024393147 XM_522051 XM_522051 TCCATCTCTTCTGAATTCATTTTCCCACGTTGTTGTGACCCAGCATCTGGAGGGAAGATA
10024393148 AY313606 AY313606 Podn CACTTTCAGAGAACAGCCTCAAGAAGGCTTGGAAGAGAAAGAGGCAGCAGTGCGTGGTGG
10024393149 D87662 D87662 Ywhaq AGCAAGGAAGCCCATTCGTGTGTATGGGATCAACTGTTATATAGTCTTTTCACACTGCAG
10024393150 Y15001 Y15001 Irx3 GTCTGACTCTTTTTGTATATACGGGAAAATGTACATACGTGTGAACCAAATTGTACAAGA
10024393151 D70848 D70848 Zic2 TATTGGCTTATTGGTGGATAGAAGTTTGTCCATTTGTAAACTCCCGGATTGCGCTCCCTC
10024393152 NP_666747 NP_666747 Olfr313 CTGAGGAACAAAGATATGAAGTTTGCTCTACAGAAACTTTATTGTGGGAGAAAGTACTGA
10024393153 AF302503 AF302503 Peli1 CCAAGTCCTGTGTTGTGTTTTGTCATTTCTGTTGAGGCTCTATATTGTAGCTTAATTTTT
10024393154 NP_002269 NP_002269 AAGGGACTCTAGCCTTCTCCTTCCCCCAACTGCAGATGGAGGAGCTTAACCAACAGGTGG
10024393155 XM_294378 XM_294378 1700007N14Rik GCTCTCAAATACTGCTTGCTGCCATATTTTCTGATGATAAATCAAATTGCTAAGCTCTGA
10024393156 AY004316 AY004316 Sorcs2 CCTGAGCTTACCTGACATGTGGGCATAGCAGAGGTGATGAGTTCTTTGTTTTTCCTTTAT
10024393157 CK835976 CK835976 4930556P03Rik TCGGCAGCGAGTCTAACACCAAACCTCATCTCCAGCTCTAAGGGGTTATTTATTAAAAAA
10024393158 NM_138670 NM_138670 Mpst TGCTAAGCTGGGGCCCACCTAGCTTGTTTCATTGTTGGGAAATAAAACATCAAGAAAAAA
10024393159 NM_146075 NM_146075 Lemd2 ACACAAGACACCCCCTTTTGGACCTATTGCTGGTCTCTGTTTCTTAATAAAGTGTGGTCT
10024393160 AF171092 AF171092 Jag1 AATAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAGCTTGAACCGGATGGAATACATC
10024393161 ri|E030017M08|PX00204L03|3785 Gata6 Gata6 GTACAGTGAGATCCTTCCTTTTCATCTTATTTCAATGCTGTGTGTGACTCTAAGGTGTCA
10024393162 AY167972 AY167972 TGCCCTCTTTGGATCATTGACATAGCTAGTCTTCAACATCCTCATACAAATTGAAGTTGC
10024393163 U02880 U02880 Krt1-12 CACAGCTTTGATGGAACCGTATGGTTTAACAACGCTAACTTTAATTAAAGATTAATGGCA

Total number of rows: 23574

Table truncated, full table size 2389 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap