GEO Accession viewer

GSE86833	Critical evaluation of the Illumina MethylationEPIC BeadChip microarray for whole-genome DNA methylation profiling
GSE89895	Impact of regulatory variation across human iPSCs and differentiated cells
GSE90867	Molecular characteristics of the KCNJ5 mutated aldosterone-producing adenomas.
GSE90933	Differential genomic-methylation profile of U937 cells transduced with WT/mutant-DNMT3A
GSE90934	Differential gene expression and genomic methylation profile of U937 cells transduced with WT/mutant-DNMT3A
GSE92462	Characterizing the epigenome of glioma stem cells (Methylation BeadChip)
GSE92469	Characterizing the epigenome of glioma stem cells
GSE92579	Validation of the MethylationEPIC BeadChip for fresh-frozen and formalin-fixed paraffin-embedded tumours (EPIC)
GSE92580	Validation of the MethylationEPIC BeadChip for fresh-frozen and formalin-fixed paraffin-embedded tumours
GSE92608	Genomic and molecular screenings unveil different mechanisms for acquired resistance to MET inhibitors in lung cancer cells
GSE93356	Ginsenoside Rh2 epigenetically regulates cell-mediated immune pathway to inhibit proliferation of the MCF-7 breast cancer cell
GSE93373	Epigenome analysis of B cell and B cells infected with Epstein-Barr virus (EBV)
GSE94677	Assessment of DNA methylation patterns in chimpanzee skeletal tissues
GSE94987	Methylation profiling of preclinical ETMR models
GSE95232	Transient and permanent changes in DNA methylation patterns in inorganic arsenic-mediated epithelial-to-mesenchymal transition
GSE95460	DNA methylation signature defines genes modulated by stromal cell contents of human breast tumors [MethylationEPIC]
GSE95462	DNA methylation signature defines genes modulated by stromal cell contents of human breast tumors
GSE95505	Lineage specific differentiation is influenced by state of human pluripotency
GSE95531	Lineage specific differentiation is influenced by state of human pluripotency [methylation]
GSE98990	DNA methylation of human colorectal cancer and HeLa sample
GSE99505	Ginsenoside Rg3 epigenetically regulates cell-mediated immune pathway to inhibit proliferation of the MCF-7 breast cancer cell
GSE99788	A distinct epigenetic profile distinguishes stenotic from non-inflamed fibroblasts in the ileal mucosa of Crohn's disease patients [methylation]
GSE100184	Hit-and-run epigenetic editing prevents senescence entry in primary breast cells from healthy donors [EPIC methylation]
GSE100208	Hit-and-run epigenetic editing prevents senescence entry in primary breast cells from healthy donors [EPIC methylation 2]
GSE100209	Hit-and-run epigenetic editing prevents senescence entry in primary breast cells from healthy donors
GSE100779	Role of Branched Chain Amino Acid Transaminase 1 (BCAT1) in Acute Myeloid Leukemia [methylation_HL60_BCAT1-OE_10weeks]
GSE100780	Role of Branched Chain Amino Acid Transaminase 1 (BCAT1) in Acute Myeloid Leukemia [methylation_HL60_BCAT1-OE_20weeks]
GSE100781	Role of Branched Chain Amino Acid Transaminase 1 (BCAT1) in Acute Myeloid Leukemia [methylation_MOLM13_BCAT1-OE_10weeks]
GSE100782	Role of Branched Chain Amino Acid Transaminase 1 (BCAT1) in Acute Myeloid Leukemia [methylation_MOLM13_BCAT1-OE_20weeks]
GSE100783	Role of Branched Chain Amino Acid Transaminase 1 (BCAT1) in Acute Myeloid Leukemia [hydroxymethylation_HL60_BCAT1-OE_12weeks]
GSE100784	Role of Branched Chain Amino Acid Transaminase 1 (BCAT1) in Acute Myeloid Leukemia
GSE100825	Genome-wide DNA methylation analysis in blood cells from patients with Werner Syndrome
GSE100850	Epigenetic alterations detected in the genome of very young breast cancer patients: identification of new biomarkers
GSE101908	Genomic Evaluation of Multiparametric Magnetic Resonance Imaging -visible and -nonvisible Lesions in Clinically Localized Prostate Cancer
GSE102031	Human Naive Pluripotency Attained by Transient Inhibition of mTOR
GSE103189	Cord blood buffy coat DNA methylation is comparable to whole cord blood methylation
GSE103271	Assessment of DNA methylation patterns related to femur bone morphology in macaque bone using the 850K array
GSE103279	Assessment of DNA methylation patterns related to femur bone morphology in baboon bone using the 850K array
GSE103280	Assessment of DNA methylation patterns related to femur bone morphology in vervet bone using the 850K array
GSE103286	Assessment of DNA methylation patterns related to osteoarthritis in baboon bone and cartilage using the 850K array
GSE103287	Assessment of DNA methylation patterns related to femur bone morphology in nonhuman primate bone using the 850K array
GSE103328	Assessment of DNA methylation patterns related to femur bone morphology in marmoset bone using the 850K array
GSE103332	Intra- and Inter-Specific Investigations of Skeletal DNA Methylation Patterns and Femur Morphology in Nonhuman Primates
GSE103498	Whole genome bisulphite sequencing using the Illumina X system [Infinium MethylationEPIC]
GSE103505	Whole genome bisulphite sequencing using the Illumina X system
GSE103541	DNA methylation profiles of Purified Blood Cell types
GSE103556	DNA methylation profiles in wild-type and IDH1 R132H/WT human astroglial cells [methylation]
GSE103558	DNA methylation and expression profiles in wild-type and IDH1 R132H/WT human astroglial cells
GSE103738	Characterization of imprinted methylation using the Illumina Infinium MethylationEPIC array platform
GSE104210	Clinical and genetic diversity and recurrent CXorf67 mutations across distinct molecular subgroups of posterior fossa type A (PFA) ependymoma.
GSE106727	MYCN Drives Disparate Medulloblastoma from Human Embryonic and iPSC-Derived Stem Cells [array]
GSE106728	MYCN Drives Disparate Medulloblastoma from Human Embryonic and iPSC-Derived Stem Cells
GSE107080	DNA methylation signatures of illicit drug injection and hepatitis C are associated with HIV frailty II
GSE107082	DNA methylation signatures of injection illicit drug use (IDU) and hepatitis C (HCV) predict HIV pathophysiologic frailty
GSE108202	Chronic Chlamydia trachomatis infection of fallopian tube organoids
GSE108982	Clonality analysis in breast tumour pairs using DNA methylation data
GSE108985	Clonal relatedness in tumour pairs of breast cancer patients
GSE109330	Chromatin blueprint of glioblastoma stem cells reveals new subtypes with unique drug sensitivities [methylation]
GSE109364	Differential genomic-methylation profile of EOL-1 cells transduced with WT/mutant-DNMT3A
GSE109399	Epigenetic characterization of glioblastoma stem cells
GSE109402	Proteogenomic Analysis of Medulloblastoma [methylation array]
GSE109403	Proteogenomic Analysis of Medulloblastoma
GSE109541	Methylation analysis of STAT3 targets in gastric cancer cells
GSE110184	Epigenetic profiling of docetaxel resistance in Breast Cancer
GSE110185	Circulating-cell free DNA pooled samples for epigenome-wide discovery of methylation biomarkers for colorectal cancer screening
GSE110274	Epigenome analysis of normal PBMC and co-cultured PBMC with human colorectal adenocarcinoma cell lines using DNA microarray
GSE110454	Whole methylome analysis of SEM cell lines
GSE110530	Longitudinal dataset: An optimized library for reference-based deconvolution of whole-blood biospecimens assayed using the Illumina HumanMethylationEPIC BeadArray (I)
GSE110544	Impact of regulatory variation across human iPSCs and differentiated cells [methylation]
GSE110554	FlowSorted.Blood.EPIC: An optimized library for reference-based deconvolution of whole-blood biospecimens assayed using the Illumina HumanMethylationEPIC BeadArray (II)
GSE110555	SuperSeries: An optimized library for reference-based deconvolution of whole-blood biospecimens assayed using the Illumina HumanMethylationEPIC BeadArray
GSE110600	Profiling DNA Methylation Differences Between Inbred Mouse Strains on the Illumina Human Infinium MethylationEPIC Microarray
GSE111165	Genome-wide DNA Methylation Comparison between Live Human Brain and Peripheral Tissues within Individuals
GSE111183	Identification of Myalgic Encephalomyelitis/Chronic Fatigue Syndrome-associated DNA methylation patterns
GSE111336	Epigenome analysis of pheochromocytoma/paraganglioma samples
GSE111541	Metabolic adaptations underlie epigenetic vulnerabilities in chemoresistant breast cancer [Methylation profiling]
GSE111627	DNA methylome evolution and reprogramming in recurrent glioblastoma
GSE111631	Genome wide DNA methylation profiling of normal saliva from females and males
GSE111807	Physiological concentration changes of intracellular spermine activates DNA methyltransferase 3A and 3B and affects gene methylation
GSE112067	Limitations of current in vitro models for testing the clinical potential of epigenetic inhibitors for treatment of pediatric ependymoma
GSE112179	DNA methylation in neurons from post-mortem brains in schizophrenia and bipolar disorder (Methylation)
GSE112525	DNA methylation in neurons from post-mortem brains in schizophrenia and bipolar disorder
GSE112596	Epigenome analysis of CD4 T cells from treated and untreated patients with multiple sclerosis (MS)
GSE112611	Blood-Derived DNA Methylation Signatures of Crohn’s Disease and Severity of Intestinal Inflammation
GSE112618	FACS validation dataset: An optimized library for reference-based deconvolution of whole-blood biospecimens assayed using the Illumina HumanMethylationEPIC BeadArray (III)
GSE112905	Changes in DNA methylation patterns associated with Gulf War Illness
GSE112924	Evaluation of cross-platform and interlaboratory concordance via consensus modelling of genomic measurements [HMEPIC array]
GSE113372	Evaluation of cross-platform and interlaboratory concordance via consensus modelling of genomic measurements
GSE113545	Cytosine methylation analysis of adult mixed phenotype acute leukemia (MPAL)
GSE113687	Metabolic adaptations underlie epigenetic vulnerabilities in chemoresistant breast cancer
GSE114163	A revised model of clonal evolution of intraductal papillary mucinous neoplasm-related pancreatic carcinogenesis
GSE114210	IG-MYC-positive neoplasms with precursor B-cell phenotype are molecularly distinct from Burkitt lymphomas
GSE114721	Genome wide methylation analysis of 16 melanoma cell lines
GSE114763	Human Muscle Posses Epigenetic Memory
GSE114989	Global DNA methylation reflects spatial heterogeneity and molecular evolution of lung adenocarcinomas
GSE115246	Epigenetic prediction of response to anti-PD-1 treatment in non-small-cell lung cancer: a multicenter, retrospective analysis
GSE115278	Epigenome-wide association study in peripheral white blood cells: Methyl Epigenome Network Association (MENA) project
GSE115382	IDH3a KO effect on global DNA methylation
GSE115413	Cancer associated fibroblasts from localised prostate cancer have a distinctive DNA methylation profile [Illumina EPIC]
GSE115508	DNA methylation profiling of acute chorioamnionitis-associated placentas and fetal membranes : insights into epigenetic variation in spontaneous preterm births
GSE115777	Comparative global methylation profile in DMS114 cells before and after acquired resistance to PD173074
GSE116298	Intra-Tumor DNA Methylation Heterogeneity in Glioblastoma; Implications for DNA Methylation-based Classification
GSE116339	Exposure to polybrominated biphenyl (PBB) associates with DNA methylation differences across the genome
GSE116402	Diesel exhaust and house dust mite allergen lead to common changes in the airway methylome and hydroxymethylome
GSE116699	DNA methylation signature reliably distinguishes pulmonary enteric adenocarcinoma from metastatic colorectal cancer
GSE116992	Genome-wide DNA methylation analysis of the whole blood of individuals with Coffin-Siris and Nicolaides-Baraitser syndromes
GSE117130	Heterogeneity within the PF-EPN-B subgroup
GSE117528	DNA methylation statuses of 293FT cells with TET depletion and NOC18 treatment
GSE117860	Smoking-associated DNA methylation features link to HIV outcomes [Infinium MethylationEPIC]
GSE117861	Smoking-associated DNA methylation features link to HIV outcomes
GSE117903	DNA methylation profiles of THP1 monocyte cells following Echinaforce treatment
GSE117904	Echinacea purpurea elicits anti-viral response in THP-1 monocytes through activation of interferon, MAPK and NF-κB signaling pathways and DNA hypermethylation of repeat elements
GSE117926	DNA methylation of two triple-negative patient-derived breast cancer xenografts
GSE118003	Expression profiling and DNA methylation of TNBCs
GSE118144	Cell lineage-specific genome-wide DNA methylation analysis of patients with paediatric-onset systemic lupus erythematosus
GSE118694	Application of the High-throughput TAB-Array for the Discovery of Novel 5-Hydroxymethylcytosine Biomarkers in Pancreatic Ductal Adenocarcinoma
GSE118970	Defining UHRF1 Domains That Support Maintenance of Human Colon Cancer DNA Methylation and Oncogenic Properties [methylation]
GSE118972	Defining UHRF1 Domains That Support Maintenance of Human Colon Cancer DNA Methylation and Oncogenic Properties
GSE119079	Tracking of epigenetic changes during hematopoietic differentiation of induced pluripotent stem cells
GSE119100	Alpha-1 Antitrypsin Deficiency Liver Disease, Mutational Homogeneity Modulated by Epigenetic Heterogeneity With Links to Obesity
GSE119260	Evaluating Liquid Biopsies for Methylomic Profiling of Prostate Cancer
GSE119526	Genome-wide DNA methylation analysis in early-stage colorectal cancer
GSE119548	ERK inhibitor treatment in Pa16C pancreatic cancer cells
GSE119592	DNA methylation characterisation of glioblastoma (GBM) cell lines.
GSE119637	Multi-level characterization of a glioblastoma cell line panel
GSE119652	DNA methylation analysis of BeWo cells stimulated by tumor necrosis factor-alpha and insulin-like growth factor-I
GSE120122	ETMR-like infantile cerebellar embryonal tumors in the extended morphologic spectrum of DICER1-related tumors
GSE120428	Gain of function DNMT3A mutations cause microcephalic dwarfism and hypermethylation of Polycomb-regulated regions (human Illumina methylation)
GSE120558	Gain of function DNMT3A mutations cause microcephalic dwarfism and hypermethylation of Polycomb-regulated regions
GSE121056	Placenta-specific DMRs maintain methylation across gestation.
GSE121377	Comprehensive DNA methylation profiling identifies novel diagnostic biomarkers for thyroid cancer
GSE121433	Analysis of epigenome reprogramming and pre-malignant transformation in bronchial epithelial cell lines
GSE121434	Analysis of transcriptome and epigenome reprogramming and pre-malignant transformation in bronchial epithelial cell lines
GSE121656	Pancreatic cancer cells render metabolic reprogramming of tumor-associated macrophages through a GARP-dependent and DNA methylation-mediated mechanism
GSE121860	A novel reprogramming strategy to generate functionally competent human hepatocytes [Illumina methylation]
GSE122038	The Molecular Landscape of ETMR at Diagnosis and Relapse [methylation]
GSE122078	The Molecular Landscape of ETMR at Diagnosis and Relapse
GSE122086	Genome wide methylation of cord blood from gestational diabetes mellitus
GSE122126	Comprehensive human cell-type methylation atlas reveals origins of circulating cell-free DNA in health and disease
GSE122148	Genome wide DNA methylation analysis of isolated endometrial epithelial cells from obese women
GSE122288	Genome wide methylation of cord blood from normal glucose tolerance pregnancies
GSE122408	Emory University African American Microbiome in Pregnancy Cohort.
GSE122469	Differentiation of Induced Pluripotent Stem Cells towards Mesenchymal Stromal Cells is Hampered by Culture in 3D Hydrogels [DNA methylation array]
GSE122546	Differentiation of Induced Pluripotent Stem Cells towards Mesenchymal Stromal Cells is Hampered by Culture in 3D Hydrogels
GSE122808	Mesenchymal transition and acquired therapy resistance of glioblastoma cells is connected to astrocyte reactivity (DNA methylation data set)
GSE122809	Mesenchymal transition and acquired therapy resistance of glioblastoma cells is connected to astrocyte reactivity
GSE122920	Relevance of temozolomide for elderly patients with MGMT promoter-methylated malignant astrocytomas outside the RTK I methylation group
GSE122994	Relevance of temozolomide for elderly patients with MGMT promoter-methylated malignant astrocytomas outside the RTK I methylation group [HD collective]
GSE123140	Azacitidine treated AML cells reveals highly variable cell surface proteome remodeling [Illumina]
GSE123185	Epigenome analysis of pheochromocytoma/paraganglioma samples (II)
GSE123211	Azacitidine treated AML cells reveals highly variable cell surface proteome remodeling
GSE123367	DNA methylation of colorectal cancer stem cells
GSE123609	Difference of DNA methylation and Chromatin accessibility of J82 SP cell and J82 NSP cell
GSE123610	Bladder cancer cell lines side population and non-side population cells
GSE123830	Engineering epigenetic memory requires co-targeting of histone methylatransferases and DNA methylatransferases [Methylation]
GSE123885	Engineering epigenetic memory requires co-targeting of histone methylatransferases and DNA methylatransferases
GSE123914	Variation in DNA methylation of human blood over a 1-year period using the Illumina MethylationEPIC array
GSE124568	Synchrony and asynchrony between an epigenetic clock and developmental timing [EPIC array]
GSE124569	Synchrony and asynchrony between an epigenetic clock and developmental timing
GSE124617	Functional and Topographic Effects on DNA Methylation Across IDH1/2 Mutant Cancers
GSE124632	DNA methylation analysis in oropharyngeal cancer [EPIC array]
GSE124633	DNA methylation analysis in oropharyngeal cancer
GSE125367	Differental DNA methylation in Nicolaides-Baraitser syndrome
GSE125386	Methylation of a gestational choriocarcinoma
GSE125450	DNA methylation analysis of astroblastomas
GSE126043	Genome-wide identification of differentially methylated promoters and enhancers associated with response to anti-PD-1 therapy in non-small cell lung cancer
GSE126045	Genome-wide identification of differentially methylated promoters and enhancers associated with response to anti-PD-1 therapy in non-small cell lung cancer
GSE126528	Assessment of on- and off-target effects of dSpCas9-DNMT3A and dSpCas9-TET1 fusion proteins and the impact of modulating promoter strength on the specificity of CRISPR/dCas9-based epigenetic editing tools
GSE126545	TCF4 germline mutation and adult-onset SHH medulloblastoma
GSE126646	Genome-wide DNA methylation profiling shows a distinct epigenetic signature associated with lung macrophages in cystic fibrosis
GSE126672	DNA methylation analysis of NNMT overexpression and knockdown in stromal cells
GSE128032	Loss of IDH1R132H mediated D-2HG production induces genome-wide demethylation in GCIMP low loci in patient-derived glioma cells
GSE128125	Transition to naïve human pluripotency mirrors pan-cancer DNA hypermethylation (data set 1)
GSE128126	Transition to naïve human pluripotency mirrors pan-cancer DNA hypermethylation (data set 2)
GSE128127	Transition to naïve human pluripotency mirrors pan-cancer DNA hypermethylation (data set 3)
GSE128128	Transition to naïve human pluripotency mirrors pan-cancer DNA hypermethylation (data set 4)
GSE128130	Transition to naïve human pluripotency mirrors pan-cancer DNA hypermethylation
GSE128218	A Patient-specific screen identifies Medulloblastoma driver genes in-vivo and in human organoids
GSE128401	Genome-wide methylation in alcohol use disorder subjects: implications for an epigenetic regulation of the cortico-limbic glucocorticoid receptors (NR3C1)
GSE128684	DNA methylation profiling of paired parental and therapy resistant cancer cell lines
GSE128685	DNA hydroxymethylation profiling of paired parental and therapy resistant cancer cell lines
GSE128686	RNA-seq and DNA methylation and hydroxymethylation profiles in sensitive and treatment-resistant cancer cell lines
GSE128784	Dicer sequencing, whole genome methylation profiling and RNA sequencing analysis in basal cell carcinoma [methylation]
GSE128795	Dicer sequencing, whole genome methylation profiling and RNA sequencing analysis in basal cell carcinoma
GSE128821	Epigenome-wide analyis of neurobehavioral variation in preterm infants
GSE129376	Impact of acute aerobic exercise on genome-wide DNA methylation in natural killer cells - a pilot study
GSE129428	Genome-wide DNA methylation in post-mortem hippocampus of patients with bipolar disorder and controls
GSE129789	Genome-wide DNA methylation profile analysis of human intervertebral disc degeneration
GSE130051	Second-generation molecular subgrouping of medulloblastoma: an international meta-analysis of Group 3 and Group 4 subtypes
GSE130093	MTAP loss promotes stemness and epigenetic reprogramming in Glioblastoma
GSE130295	BAP1 loss triggers DNA methylomic repatterning in highly aggressive Class 2 uveal melanomas [MethylationEPIC]
GSE130357	BAP1 loss triggers DNA methylomic repatterning in highly aggressive Class 2 uveal melanomas
GSE130641	Difference of DNA methylation and Chromatin accessibility of T24 SP cell and T24 NSP cell
GSE130748	Longitudinal Study of Leukocyte DNA Methylation and Biomarkers for Cancer Risk in Older Adults
GSE130844	Genome-wide 5-hydroxymethylcytosine (5hmC) emerges at early stage of in vitro hepatocyte differentiation [Methylation]
GSE130849	Genome-wide 5-hydroxymethylcytosine (5hmC) emerges at early stage of in vitro hepatocyte differentiation
GSE131177	Comparison of the DNA methylation profiles of CD14+ monocytes (MO) from human peripheral blood with M-CSF macrophages differentiated in the presence of DMSO (MAC) or 50µM cambinol (Camb) for 5 days
GSE131280	DNA Methylation of primary human fibroblasts across replicative lifespan in normal and hyperglycemic conditions
GSE131295	Epigenetic analysis of DU-4475 human breast cell line
GSE131433	Epigenome-wide Association study of individuals conceived by Assisted Reproduction Technologies at birth and adulthood
GSE131482	Methylation data from radiation-induced glioma and reference cohort
GSE131945	Quality control measures for placental sample purity in DNA methylation array analyses
GSE131973	Methylation in Adaptive Natural Killer cells after exposure to NKG2C agonist antibodies for 7 days
GSE132181	Genome wide blood DNA methylation measured at birth and age 7 on the EPIC array
GSE132203	DNA Methylation (EPIC) from the Grady Trauma Project
GSE132219	Epigenetic footprint of hepatoblastoma defines a novel integrative molecular classification with clinical implications
GSE132399	Epigenetic footprint of hepatoblastoma defines a novel integrative molecular classification with clinical implications [Infinium MethylationEPIC]
GSE132406	Methylation analysis of Epstein-Barr virus-associated gastric cancer case
GSE132513	Epigenetic remodelling of enhancers in response to estrogen deprivation and re-stimulation [methylArray]
GSE132514	Epigenetic remodelling of enhancers in response to estrogen deprivation and re-stimulation
GSE132547	DNA methylation changes in regional lung macrophages are associated with metabolic differences
GSE132616	ELOVL2 is a novel tumor suppressor attenuating tamoxifen resistance in breast cancer via suppressing the AKT pathway [methylation 850K]
GSE132617	ELOVL2 is a novel tumor suppressor attenuating tamoxifen resistance in breast cancer via suppressing the AKT pathway
GSE132650	Mayo GBM Patient Derived Xenograft National Resource
GSE132690	Identification of molecular signatures associated with early relapse after complete resection of lung adenocarcinomas
GSE132804	Dysfunctional epigenetic aging of the normal colon and colorectal cancer risk
GSE132845	Epigenetic analysis of BlaER1 transdifferentiation
GSE132866	DNA methylation Profiling in Autoimmune encephalitis (AE): DNA methylation profile in healthy control (HC) sujects and acute-phase AE subjects
GSE133355	Bangladeshi women living in UK: Buccal cell DNA methylation analysis
GSE133556	Differential DNA Methylation in High Grade Serous Ovarian Cancer (HGSOC) is associated with Tumor Behavior
GSE133774	Clinical spectrum of multi-locus imprinting disturbances associated with maternal-effect variants range from overt Beckwith-Wiedemann syndrome to apparently healthy phenotype
GSE133801	DNA methylation analysis of pineoblastoma
GSE133985	Epigenetic field cancerization in breast cancer using subject-matched tumor, ipsilateral-normal, and contralateral-normal tissues
GSE133986	Genome wide DNA methylation of pediatric acute myeloid leukemia
GSE134089	Epigenome analysis of NET samples
GSE134165	PPM1D Mutations Silence NAPRT Gene Expression and Confer NAMPT Inhibitor Sensitivity in Glioma
GSE134217	Aggressive PDACs show hypomethylation of repetitive elements and the execution of an intrinsic IFN program linked to a ductal cell-of-origin [EPIC methylation data on cell lines and PDXs]
GSE134293	Genome-wide DNA demethylation of HML58-3 (a derivative cell line of HCT116) after treatment of DAC, OR-2003, and OR-2100
GSE134425	Inflammatory Cytokines shape a Changing DNA Methylome in Monocytes Mirroring Disease Activity in Rheumatoid Arthritis (in vitro)
GSE134429	Inflammatory Cytokines shape a Changing DNA Methylome in Monocytes Mirroring Disease Activity in Rheumatoid Arthritis (patients)
GSE135063	Dynamic changes of muscle insulin sensitivity after metabolic surgery IV
GSE135066	Dynamic changes of muscle insulin sensitivity after metabolic surgery
GSE135205	Epic methylation arrays of DNMT1 inhibitor treated AML cell lines
GSE135206	MethylationEPIC array of DNMT1 inhibitor treated AML cell lines - part II
GSE135207	Expression profiling and methylation analysis of DNMT1 inhibitor treated AML cell lines
GSE135672	An integrative analysis of genome-wide methylation and expression in ameloblastoma
GSE135802	DNA methylation analysis of HCT116 after knockdown and rescue of UHRF1
GSE135905	Genetic influences on DNA methylation (mQTL) in pediatric Crohn's disease patients
GSE136296	Age-Associated Epigenetic Change in Chimpanzees and Humans
GSE136361	Isomorphic diffuse glioma is a distinct tumour entity with recurrent gene fusions of MYBL1 or MYB and a benign disease course
GSE136380	DNA methylation data of tumor and non-tumor liver tissues from Peruvian patients with hepatocellular carcinoma (HCC)
GSE136583	DNA hydroxy-methylation data of tumor and non-tumor liver (NTL) tissues from Peruvian patients with hepatocellular carcinoma (HCC)
GSE136790	Epigenome analysis of uterin and ovarian carcinosarcoma tissues
GSE136791	Epigenome analysis of endometrial endometrioid adenocarcinoma tissues
GSE137360	Targeting aberrant DNA methylation in mesenchymal stromal cells as a treatment for myeloma bone disease [methylation]
GSE137416	Targeting aberrant DNA methylation in mesenchymal stromal cells as a treatment for myeloma bone disease [methylation II]
GSE137419	Targeting aberrant DNA methylation in mesenchymal stromal cells as a treatment for myeloma bone disease
GSE137452	Epigenome analysis of Control and PLX4032 Resistant Clones with EPIC array.
GSE137503	The PedBE clock accurately estimates DNA methylation age in pediatric buccal cells
GSE137593	Early arthritis CD4+ T cell DNA methylation profiling
GSE137594	Early arthritis B cell DNA methylation profiling
GSE137634	Lymphocyte DNA methylation mediates genetic risk at shared immune mediated disease loci
GSE137682	The PedBE clock accurately estimates DNA methylation age in pediatric buccal cells [dataset 8, BIBO]
GSE137841	The PedBE clock accurately estimates DNA methylation age in pediatric buccal cells [dataset 11,UCI]
GSE137845	Epigenome analysis of glioma patient surgical samples and corresponding xenotransplants and cell lines
GSE137904	The PedBE clock accurately estimates DNA methylation age in pediatric buccal cells [dataset 16, GUSTO]
GSE137913	In silico APC/C substrate discovery reveals cell-cycle-dependent degradation of UHRF1 and other chromatin regulators
GSE138074	Inflammatory cytokines and organ dysfunction associate with the aberrant DNA methylome of monocytes in sepsis
GSE138221	Methylation profiling of Desmoplastic myxoid tumor
GSE138307	Genome-wide Methylation Profiles of femoral bones
GSE138348	Effects of Electronic Cigarette Constituents on the Human Lung: A Pilot Clinical Trial [methylation]
GSE138351	Effects of Electronic Cigarette Constituents on the Human Lung: A Pilot Clinical Trial
GSE138550	ATXN1-NUTM1 may define a new brain tumor entity and expand the histologic spectrum of NUTM1-rearranged neoplasia
GSE138597	Differential 5-methylcytosine and 5-hydroxymethylcytosine in Parkinson’s and Alzheimer’s Disease.
GSE138653	Multi-omics and Machine Learning Accurately Predicts Clinical Response to Adalimumab and Etanercept Therapy in Patients with Rheumatoid Arthritis [Methylation array]
GSE138747	Multi-omics and Machine Learning Accurately Predicts Clinical Response to Adalimumab and Etanercept Therapy in Patients with Rheumatoid Arthritis
GSE138864	A KHDC3L mutation resulting in recurrent hydatidiform mole causes genome-wide DNA methylation loss in oocytes and persistent imprinting defects post-fertilisation.
GSE138865	DNA Methylation of BT142 and TS603 cell lines
GSE138873	Metabolic Reprogramming Associated with Aggressiveness Occurs in the G-CIMP-High Molecular Subtypes of IDH1mut Lower Grade Gliomas
GSE139211	Epigenome analysis of statin-treated SGBS pre-adipocytes during differentiation
GSE139320	Genome-wide study of human methylation profile of J-Lat cells upon EGCG-treatment and UHRF1 knockdown
GSE139410	Chordoma and osteosarcoma cell lines Illumina Infinium MethylationEPIC array
GSE139687	Whole-genome DNA methylation profiling of ESR1 Q375H and R394H mutations from the human breast cancer MB-231 stable cells.
GSE140078	Molecular atlas of fetal and adult human liver sinusoidal endothelial cells: a F8 secreting cell [methylation I]
GSE140079	Molecular Analysis of Fetal and Adult Primary Human Liver Sinusoidal Endothelial Cells: A Comparison to Other Endothelial Cells
GSE140124	Epigenome analysis of pediatric bithalamic diffuse gliomas
GSE140170	DNA methylation analysis in malignant melanoma clinical samples [EPIC array]
GSE140171	DNA methylation analysis in malignant melanoma clinical samples
GSE140344	DNA methylome comparison of low IQ versus high IQ trisomy 21
GSE140686	Sarcoma Classification by DNA-methylation profiling
GSE140692	The prandial status modifies the associations of BMI and fatty acids with DNA methylation in men
GSE141039	DNA methylation data from 153 ATRT tumor samples
GSE141065	Epigenome analysis of cord blood DNA from infants born into the UPBEAT study
GSE141106	DNA methylation - PRDM8 reveals aberrant DNA methylation in aging syndromes and is relevant for hematopoietic and neuronal differentiation.
GSE141108	PRDM8 reveals aberrant DNA methylation in aging syndromes and is relevant for hematopoietic and neuronal differentiation.
GSE141254	DNA methylation analysis validates organoids as a viable model for studying human intestinal aging (methylation)
GSE141256	DNA methylation analysis validates organoids as a viable model for studying human intestinal aging
GSE141363	DNA methylation data from 13 ATRT tumor samples
GSE141521	Epigenetic signature of human induced pluripotent stem cells identified with the linear machine learning model
GSE141659	DNA methylation changes in undifferentiated and differentiated human primary epithelial cells of antrum, corpus, and fundus
GSE141660	Changes in undifferentiated and differentiated human primary epithelial cells of antrum, corpus, and fundus
GSE141682	DNA methylation profiling of whole blood from Han Chinese individuals: identification of age-related CpG sites for forensic use
GSE142141	Genome-wide association between DNA methylation and fiber type composition in skeletal muscle
GSE142302	Epigenetic profiling of 16 look-alike human couples
GSE142304	Whole genome SNP array and epigenetic profiling of 16 look-alike human couples
GSE142320	Multiplatform molecular profiling reveals epigenomic intratumor heterogeneity in ependymoma, DNA Methylation
GSE142439	Transient non-integrative nuclear reprogramming promotes multifaceted reversal of aging in human cells
GSE142512	Longitudinal DNA methylation differences precede type 1 diabetes
GSE142627	Methylation Profiling of Medulloblastoma in a Clinical Setting Permits Sub-Classification and Reveals New Outcome Predictions
GSE142801	Extracellular vesicles from Pseudomonas aeruginosa suppress MHC-related molecules in human Lung Macrophages
GSE143157	Epigenome-Wide Association Study in multiple system atrophy (MSA)
GSE143307	Epigenomics of vitamin K response to supplementation
GSE143614	DNA methylation profiles of IRAK-M gene in untreated or drug-treated human melanoma cell lines
GSE143752	Genome-wide DNA methylation profiling identifies two novel genes in cervical neoplasia
GSE143842	Methylome analyses of three glioblastoma cohorts reveal chemotherapy sensitivity markers within DDR genes [Heidelberg cohort part 2]
GSE143843	Methylome analyses of three glioblastoma cohorts reveal chemotherapy sensitivity markers within DDR genes
GSE144129	DNA methylation and hydroxymethylation assessment through Illumina EPIC array analysis of paired bisulfite and oxidative-bisulfite conversion
GSE144213	The DNA Methylation Landscape of the Human Cancer Organoids Available at the American Type Culture Collection
GSE144359	Intratumoral heterogeneity of DNA methylation in an ovarian metastasis from lobular breast cancer
GSE144425	Effects of genetic variation on gene expression revealed following hypoxic stress in cardiomyocytes [methylation]
GSE144426	Effects of genetic variation on gene expression revealed following hypoxic stress in cardiomyocytes
GSE144487	Analysis of DNA methylation-based tumor immune microenvironment patterns in metastatic melanoma
GSE144669	DNA methylation profiling of proliferating and differentiating keratinocytes
GSE144910	DNA methylation in the superior temporal gyrus of 44 subjects with schizophrenia and 44 non-psychiatric control subjects
GSE145113	Distinguishing active versus passive DNA demethylation using Illumina MethylationEPIC BeadChip microarrays
GSE145156	Epigenome-Wide DNA Methylation Analysis of Small Cell Lung Cancer Cell Lines Suggests Potential Chemotherapy Targets
GSE145233	EPIC analysis of Brazilian babies born with congenital microcephaly
GSE145588	DNA methylome analysis of DNA methyltransferase inhibitor reagent-treated lung cancer cells
GSE145664	Epigenetic therapy strengthens immune synapses to potentiate susceptibility of lung cancer cells to adoptive γδ T cell therapy
GSE145714	DNA hyper-methylation during Tuberculosis dampens host immune responsiveness
GSE146003	Global DNA methylation patterns in primary anaplastic thyroid cancer
GSE146092	Epigenomic and transcriptomic analysis of Systemic Sclerosis CD4+ T cells [Illumina]
GSE146093	Epigenomic and transcriptomic analysis of Systemic Sclerosis CD4+ T cells
GSE146179	DA Methylation patterns in decitabine treated 786-0 cells
GSE146376	Genome-wide gene methylation study in primary cultured airway smooth muscle cells
GSE146377	Genome-wide gene expression and methylation studies in primary cultured airway smooth muscle cells
GSE146426	Metabolic Regulation of the Epigenome Drives Lethal Infantile Ependymoma
GSE146502	DNA methylation changes induced by hypomethylating agent, Azacitidine (AZA); IDH1 inhibitor, BAY1436032 (BAY) and sequential and simultaneous combination of BAY and AZA in in vitro treated human (CD45+) cells isolated from the bone marrow of IDH1mut
GSE146504	DNA methylation and gene expression changes induced by hypomethylating agent, Azacitidine (AZA), BAY1436032 (BAY) and sequential and simultaneous combination of BAY and AZA in in vitro treated human (CD45+) cells isolated from the bone marrow of IDH1mut
GSE146551	Multi-omics analysis of dynamic dose-response in macrophages recapitulates multi-walled carbon nanotube -induced lung fibrosis [methylation]
GSE146710	Multi-omics analysis of dynamic dose-response in macrophages recapitulates multi-walled carbon nanotube -induced lung fibrosis
GSE147040	Genome-wide DNA methylation differences in nucleus accumbens of smokers vs. nonsmokers
GSE147058	Harsh Parenting Predicts Novel HPA Receptor Gene Methylation and NR3C1 Methylation Predicts Cortisol Daily Slope in Middle Childhood
GSE147318	Saliva cell type DNA methylation reference panel for epidemiology studies in children
GSE147391	Differential DNA methylome between low and high-grade gliomas
GSE147430	Smoking effect on DNA methylation in human blood CD8T cells
GSE147518	DNA methylation analysis of HCT116 after knockdown of LIG1, UHRF1, or luciferase (control)
GSE147537	An open-label, phase II basket study of an oral hypomethylating agent CC-486 and durvalumab in advanced solid tumors
GSE147667	Epigenetic blueprint identifies poor outcome and hypomethylating agent-responsive T-ALL subgroup
GSE147740	DNA methylation analysis of human peripheral blood mononuclear cell collected in the AIRWAVE study
GSE148086	DNA methylation analysis of HCT116 after disruption of methyllysine reading and writing.
GSE148314	A new hypomethylating agent, OR-2100, resists degradation by cytidine deaminase, leading to favorable oral absorbability and anti-leukemia effects
GSE148388	MiR-1253 exerts tumor-suppressive effects in medulloblastoma via inhibition of CDK6 and CD276 (B7-H3) (Infinium MethylationEPIC dataset)
GSE148390	MiR-1253 exerts tumor-suppressive effects in medulloblastoma via inhibition of CDK6 and CD276 (B7-H3)
GSE148748	DNA methylation profiling of 82 triple negative breast cancers with BRCA1 promoter methylation or BRCA1 mutation using the Illumina EPIC 850K platform.
GSE148766	Prognostic epigenetic 12-genes signature in human metastatic colorectal carcinomas
GSE148906	DNA methylation profiling of 154 triple negative breast cancers using the Illumina EPIC 850K platform
GSE148960	Characterization of the ZFX family of transcription factors that bind downstream of the start site of CpG island promoters [EPIC array]
GSE149282	Genome-wide open chromatin methylome profiles in colorectal cancer
GSE149318	DNA methylation covariation in human whole blood and sperm
GSE149411	Highly recurrent CBS epimutations in gastric cancer CpG island methylator phenotypes and inflammation
GSE149412	Dioxin-like compound exposures and DNA methylation in the Anniston Community Health Survey Phase II
GSE149568	Multi-locus imprinting disturbances in a family harboring a ZFP57 truncation
GSE149747	Methylation Diet and Lifestyle
GSE150122	DNA Methyaltion of Human Cortical Organoids
GSE150417	Genome-wide DNA Methylation Analysis along the Progression of Gastric Marginal Zone B-cell Lymphoma of MALT Type
GSE150643	Distinctions between sex and time in patterns of DNA methylation across puberty
GSE150654	Methylation profiles of microglandular adenosis
GSE151407	Skeletal muscle DNA methylation profiles in young healthy men before and after acute and chronic HIIT
GSE151485	Effect of short-term prescription opioids on DNA methylation of the OPRM1 promoter
GSE151600	Highly accurate Skin-Specific methylome analysis algorithm as a platform to screen and validate therapeutics for healthy aging [DS1]
GSE151601	Highly accurate Skin-Specific methylome analysis algorithm as a platform to screen and validate therapeutics for healthy aging [DS2]
GSE151602	Highly accurate Skin-Specific methylome analysis algorithm as a platform to screen and validate therapeutics for healthy aging [DS3]
GSE151603	Highly accurate Skin-Specific methylome analysis algorithm as a platform to screen and validate therapeutics for healthy aging [DS4]
GSE151604	Highly accurate Skin-Specific methylome analysis algorithm as a platform to screen and validate therapeutics for healthy aging [DS5]
GSE151617	Highly accurate Skin-Specific methylome analysis algorithm as a platform to screen and validate therapeutics for healthy aging
GSE151861	Epigenome analysis of HDAC1 stably knocked down HCT116 cell [Illumina EPIC]
GSE151862	Epigenome analyses of HCT116 cells stably expressing UHRF1 mutant [Illumina EPIC]
GSE151865	Epigenome analysis of HDAC1 stably knocked down HCT116 cells and HCT116 cells stably expressing UHRF1 mutant
GSE152006	A distinct metabolic response characterizes sensitivity to EZH2 inhibition in multiple myeloma
GSE152026	Blood DNA methylation profiles from first episode psychosis patients and controls I
GSE152035	Patient-Derived Orthotopic Xenografts and Cell Lines from Pediatric High-Grade Glioma Recapitulate Heterogeneity of Histopathology, Molecular Signatures and Drug Response
GSE152245	Comparison of Methylation Capture Sequencing and Infinium EPIC Methylation Array in Peripheral Blood Mononuclear Cells [EPIC array]
GSE152427	Episignatures stratifying ADNP syndrome show modest correlation with phenotype [Methylation]
GSE152428	Episignatures stratifying ADNP syndrome show modest correlation with phenotype
GSE152519	Methylation profiles of PMF with and without progression to myelofibrosis
GSE152541	Structure of DNA methyltransferases DNMT3A/DNMT3B bound to a nucleosome [array]
GSE152640	Structure of DNA methyltransferases DNMT3A/DNMT3B bound to a nucleosome
GSE152653	Epigenome analysis of low-grade neuroepithelial tumors with FGFR1 alterations
GSE152923	Comparison of Methylation Capture Sequencing and Infinium EPIC Methylation Array in Peripheral Blood Mononuclear Cells
GSE153211	Loss-of-function maternal-effect mutations of PADI6 are associated with familial and sporadic Beckwith-Wiedemann Syndrome with multi-locus imprinting disturbance
GSE153246	Epigenome-wide DNA methylation of the BEAS-2B cells post-chronic exposure to SWCNTs for 60 days
GSE153347	Evolution of AML genome and epigenome with IDH inhibitors and their association with clinical response and resistance [methylation]
GSE153349	Evolution of AML genome and epigenome with IDH inhibitors and their association with clinical response and resistance
GSE153475	NTF3 as a biomarker for prediction allergic diseases in children postnatal or adolescence
GSE153564	DNA methylation reorganization of skeletal muscle-specific genes in response to gestational obesity
GSE153668	DNA Methylation Profile in Human Cord Blood Mononuclear Leukocytes from Term Neonates: Effects of Histological Chorioamnionitis
GSE154471	An RNA-based platform to neutralize DNMT1 function AptaDiR is an innovative RNA-based platform to neutralize DNMT1 function
GSE154626	Time-resolved DNA methylation profiling of endocrine resistance in the T47D luminal A breast cancer cell line
GSE154683	Epigenomic profiles of African American Transthyretin Val122Ile carriers reveals putatively dysregulated amyloid mechanisms
GSE154915	Epigenome analysis of cord blood DNA from infants born into the SWS study
GSE154980	Epigenome analysis of muscle tissue samples from male participants of the Hertfordshire Sarcopenia Study (HSS) and Hertfordshire Sarcopenia Study extension (HSSe)
GSE155195	Epigenome analysis of normal and FHRCC samples
GSE155207	Epigenome analysis of normal and FHRCC samples
GSE155311	The methylomic landscape of fallopian tube lesions associated with ovarian high grade serous carcinoma
GSE155426	DNA Methylation Patterns of Chronic Explosive Breaching in U.S. Military Warfighters
GSE155660	Epigenome analysis of primary intracranial sarcoma
GSE155761	The methylomic landscape of fallopian tube lesions associated with ovarian high-grade serous carcinoma
GSE156012	Epigenetic methylation chip analysis of childhood medulloblastoma patient samples
GSE156053	Childhood medulloblastoma
GSE156299	DNA methylation profiling of normal, precursor lesion and cholangiocarcinoma samples
GSE156358	Epigenome analysis of paragangliomas of the filum terminale/cauda equina
GSE156359	Defining a methylation signature associated with operational tolerance in renal transplant
GSE156374	DNA methylation and copy number profiling in polymicrogyria
GSE156512	Hypermethylation and global remodeling of DNA methylation associated with acquired cisplatin resistance in testicular germ cell tumors
GSE156984	Epigenome wide association study of post-mortem Alzheimer’s Disease samples
GSE156996	Genome Wide DNA Methylation in the Neuronal Fraction of the Prefrontal Cortex from Depressed, Suicide, and Normal Control Subjects
GSE157078	Epigenome analysis of normal and DNMT3L-overexpressing human neurons [array]
GSE157081	Normal and DNMT3L-overexpressing human neurons
GSE157131	Methylation data from stored peripheral blood leukocytes from African American participants in the GENOA study
GSE157252	Epigenome analysis of normal and recent onset psychosis samples
GSE157273	Longitudinal analysis of personal cfDNA methylome patterns in metastatic prostate cancer [plasma]
GSE157397	Germline-driven replication repair-deficient high-grade gliomas exhibit unique hypomethylation patterns hypomethylation patterns
GSE157611	Age-Related Differences in Monocyte DNA Methylation and Immune Function in Healthy Kenyan Adults and Children
GSE157908	Human neurodevelopmental samples
GSE157914	Pathogenesis, Clinical and Biological Predictors of Growth in Environmental enteric dysfunction (EED): An Infant Birth Inception Cohort
GSE158063	Smaller stature in childhood following assisted reproductive technologies (ART) is not explained by parental or gestational factors, early childhood environment, or fetal DNA methylation [GUSTO_buffy_coat]
GSE158064	Smaller stature in childhood following assisted reproductive technologies (ART) is not explained by parental or gestational factors, early childhood environment, or fetal DNA methylation
GSE158089	Characterisation of DNA methylomic signatures of induced pluripotent stem cells during neuronal differentiation
GSE158422	DNA methylation features of LUSC in promoter and enhancer region [methylation]
GSE158433	DNA methylation features of LUSC in promoter and enhancer region
GSE158598	RNA splicing factors SRRM3 and SRRM4 distinguish molecular phenotypes of castration-resistant neuroendocrine prostate cancer [methylation]
GSE158599	RNA splicing factors SRRM3 and SRRM4 distinguish molecular phenotypes of castration-resistant neuroendocrine prostate cancer
GSE158612	In vitro expansion of cirrhosis derived liver epithelial cells reveals progenitor-like properties [methylation]
GSE159096	Mutational signatures define immune and Wnt-associated subtypes of ampullary carcinoma [methylation]
GSE159099	Mutational signatures define immune and Wnt-associated subtypes of ampullary carcinoma
GSE159227	The JAK2-STAT pathway epigenetically regulates tolerized genes during the first encounter to bacterial antigens [array]
GSE159250	The JAK2-STAT pathway epigenetically regulates tolerized genes during the first encounter to bacterial antigens
GSE159526	Cell-specific Characterization of the Placental Methylome
GSE159655	Epigenetic alterations underlie airway macrophage differentiation and phenotype during lung fibrosis
GSE159898	Identification of genomic methylation markers for colorectal cancer diagnosis and toxicity of capecitabine-based chemotherapy
GSE159907	DNA methylation analysis of acute myeloid leukemia (AML)
GSE159930	Rare genetic variation at transcription factor binding site modulates local DNA methylation profiles
GSE160958	Potential importance of early focal radiotherapy following gross total resection for long-term survival in children with embryonal tumors with multilayered rosettes (ETMR)
GSE161175	EPIC-based DNA methylation analysis of glioblastoma stem cells.
GSE161476	A longitudinal and transancestral analysis of DNA methylation patterns and disease activity in lupus patients
GSE161651	Epigenome analysis of upper-tract urothelial carcinomas samples and normal adjacent tissue (NAT)
GSE161678	Longitudinal multi-omics identifies responses of megakaryocytes, erythroid cells and plasmablasts as hallmarks of severe COVID-19 trajectories [methylation]
GSE161692	Atypical teratoid/rhabdoid tumors (ATRTs) with SMARCA4 mutation are molecularly distinct from SMARCB1 deficient cases
GSE161778	Longitudinal multi-omics identifies responses of megakaryocytes, erythroid cells and plasmablasts as hallmarks of severe COVID-19 trajectories
GSE161944	Mutations within FGFR1 and BRAF indicate superior outcome in diffuse midline gliomas, H3F3A K27M mutant
GSE161988	Epigenetic clocks are not accelerated in COVID-19 patients
GSE162058	Epigenetic biomarkers for EZH2 inhibitor sensitivity in neuroblastoma [array]
GSE162059	Epigenetic biomarkers for EZH2 inhibitor sensitivity in neuroblastoma
GSE162288	The comparative methylome and transcriptome after change of direction compared to straight line running exercise in human skeletal muscle
GSE162606	Hypoxia exposure and methylation
GSE162731	Methylation analysis of STAT3 targets in gastric cancer patient samples
GSE162984	EPIC-HPS
GSE163322	GATA6 is predicted to regulate DNA methylation in an in vitro model of human hepatocyte differentiation (DE)
GSE163324	GATA6 is predicted to regulate DNA methylation in an in vitro model of human hepatocyte differentiation (HEP)
GSE163331	GATA6 is predicted to regulate DNA methylation in an in vitro model of human hepatocyte differentiation
GSE163521	DNA methylation profiling identifies two distinct subgroups in breast cancers with low hormone receptor expression, mainly associated with HER2 amplification status
GSE163840	DNA methylation of fibroblasts from Cockayne syndrome and UV-sensitivity syndrome patients [EPIC]
GSE163841	DNA methylation of fibroblasts from Cockayne syndrome and UV-sensitivity syndrome patients
GSE164056	DNA Methylation Differences Associated with Social Anxiety Disorder and Early Life Adversity
GSE164083	DNA methylome analysis of esophageal squamous cell carcinoma
GSE164149	Genome-wide DNA methylation profile of expanded human CRISPR/HDR-mediated FOXP3-KO naive Tregs, Cas9 naive Tregs, and conventional T cells
GSE164195	Cardiac DNA Methylation Underlies Racial and Socioeconomic Disparities among Patients with End-Stage Heart Failure (MethylationEPIC array)
GSE164197	Racial and Socioeconomic Disparity Associates with Differences in Cardiac DNA Methylation among Men with End-Stage Heart Failure
GSE164269	DNA methylation profiling of malignant pleural mesothelioma
GSE164468	Distinct DNA methylation patterns of rheumatoid arthritis peripheral blood and synovial tissue T cells
GSE164822	Epigenome-wide study of brain DNA methylation following acute opioid intoxication
GSE164994	Epigenome analysis of intracranial mesenchymal tumors with FET-CREB fusions
GSE165050	Infinium MethylationEPIC BeadChip array data for HGSOC PH039 PDXs at baseline and treated with cycles of 100 mg/kg niraparib for 21 days for four treatment rounds and murine sample.
GSE165052	Characterization of a RAD51C-Silenced High Grade Serous Ovarian Cancer Model During PARP Inhibitor Resistance Development
GSE165178	Multi-omic rejuvenation of human cells by maturation phase transient reprogramming [Sendai array]
GSE165179	Multi-omic rejuvenation of human cells by maturation phase transient reprogramming [Transient array]
GSE165180	Multi-omic rejuvenation of human cells by maturation phase transient reprogramming
GSE165185	Multi-omics analysis of myelodysplastic syndromes resistance to epigenetics threrary reveals PI3K/Akt activation mediated by epigenetic silencing of PTEN and epi-transcriptional silencing of MDM2 [methylome]
GSE165188	Multi-omics analysis of myelodysplastic syndromes resistance to epigenetics threrary reveals PI3K/Akt activation mediated by epigenetic silencing of PTEN and epi-transcriptional silencing of MDM2
GSE165239	DNA methylation statuses in ARID1A KO cells
GSE165356	Evidence for CD04+ T Cell Methylation Signatures of Network-oriented SOCS3, ITGAL, and NR4A2 Genes with Hemodynamics in Patients with Pulmonary Arterial Hypertension (Array1 DataSet)
GSE165357	Evidence for CD04+ T Cell Methylation Signatures of Network-oriented SOCS3, ITGAL, and NR4A2 Genes with Hemodynamics in Patients with Pulmonary Arterial Hypertension (Array2 DataSet)
GSE165360	Evidence for CD04+ T Cell Methylation Signatures of Network-oriented SOCS3, ITGAL, and NR4A2 Genes with Hemodynamics in Patients with Pulmonary Arterial Hypertension
GSE165688	DNA methylation data of PAC PDX models after Gemcitabine treatment
GSE165764	Integrative genomic analysis of gemcitabine resistance in pancreatic cancer by patient-derived xenograft models
GSE165803	Opioid receptor signaling suppresses leukemia by inducing TET-dependent DNA demethylation
GSE166067	DNA methylation and transciptomic signatures in patients with peanut- and multi-food allergy [array]
GSE166068	DNA methylation and transciptomic signatures in patients with peanut- and multi-food allergy
GSE166207	DNA methylation changes in glial cells implicate functional changes in oligodendrocytes, astrocytes and microglial cells in the normal appearing white matter of Multiple Sclerosis patients
GSE166212	Colorectal Cancer DNA Methylation
GSE166373	Hypomethylation mediates genetic association with the major histocompatibility complex genes in Sjögren's syndrome
GSE166569	Astroblastomas exhibit radial glia stem cell lineages and differential expression of imprinted and X-inactivation escape genes [methylation]
GSE166587	DNA methylation data for VPS39-silenced human muscle cells and controls
GSE166844	DNA methylation profiles of Purified Blood Cell types
GSE166845	Analysis of the transcriptome and DNA methylome in response to acute and recurrent low glucose in human primary astrocytes (BeadChip)
GSE166848	Analysis of the transcriptome and DNA methylome in response to acute and recurrent low glucose in human primary astrocytes
GSE167104	Distinct sub-cellular autophagy impairments occur independently of protein aggregation in aged induced neurons from patients with Huntington’s disease
GSE167347	Medulloblastoma in adults: Cytogenetic phenotypes identify prognostic subgroups
GSE167429	Placental uptake and metabolism as determinants of pregnancy vitamin D status [Array]
GSE167431	Placental uptake and metabolism as determinants of pregnancy vitamin D status
GSE167883	Contiguous Erosion of the Inactive X in Human Pluripotency Concludes With Global DNA Hypomethylation
GSE167885	Dataset for Placental Genomic and Epigenomic Signatures in Infants Borns at Extremely Low Gestational Age [DNA methylation]
GSE167998	FlowSorted.BloodExtended.EPIC: An Enhanced DNA Methylation Library for Deconvoluting Peripheral Blood
GSE168185	Interferon drives hepatitis C virus scarring of the epigenome and creates targetable vulnerabilities following viral clearance [array]
GSE168186	Hepatitis C virus scarring of the epigenome and creates targetable vulnerabilities following viral clearance
GSE168225	Sequential azacitidine and carboplatin can prime high-grade serous ovarian cancer to respond to checkpoint inhibitor immunotherapy
... Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here

Data table

SPOT_ID

AddressA_ID

AlleleA_ProbeSeq

AddressB_ID

AlleleB_ProbeSeq

Infinium_Design_Type

Next_Base

Color_Channel

Forward_Sequence

Genome_Build

CHR

MAPINFO

SourceSeq

cg07881041

0085713262

CTACAAATACAACACCCTCAACCCATATTTCATATATTATCTCATTTAAC

CTGCACGCCTACTGCAGGTGCAGCACCCTCAGCCCATGTTTCATGTATTATCTCATTTAA[CG]CATGTATCATCTCATTTAATGCATGCATTATCTCATTTAATTCTCACAACCCCTCAGGTG

5236016

TGCAGGTGCAGCACCCTCAGCCCATGTTTCATGTATTATCTCATTTAACG

cg18478105

0046761277

AAATAAATTTCACTCTCAAATCCCAATCTCATACAACAAAACAAAAACCA

0086644198

AAATAAATTTCGCTCTCAAATCCCAATCTCGTACGACGAAACGAAAACCG

Grn

TCCCGTCTTACGGGATGGATTTCGCTCTCAGGTCCCAGTCTCGTGCGGCGGGGCGGGGAC[CG]CAGCCGGCTGGGCGGGGAAGCCCTGAGCCGGGGAAGTCACGTGGGGCGTGTCCGGAGGCG

61847650

CGGTCCCCGCCCCGCCGCACGAGACTGGGACCTGAGAGCGAAATCCATCC

cg23229610

0021717843

ATAAAATTCTTTCCTTAAAAAACATTAAAACCAAAATAAACAAAAATTCC

GTTTCTGGACAGTAAAATTCTTTCCTTGAAGGACATTAGGGCCAAAATGGGCAAGGATTC[CG]AGATTGGTACATCGAGCGTTATCTTCCAACTCTCTTTTCTAAATGGGCTCATTTAGTAAT

6841125

CGGAATCCTTGCCCATTTTGGCCCTAATGTCCTTCAAGGAAAGAATTTTA

cg03513874

0029622133

ACAATAAAATAATAAAATCCCATCACTACTTACCCTCCTTAAATAATATC

ATTGTGCCCACCTTGCTGCTGACAGTTAAGCATCACTAAAGTAGGAAATAGGGTCCAAAC[CG]ACACTACTTAAGGAGGGCAAGTAGTGATGGGACCTCATCATCCCATTGCTATCATGGAGC

198303466

CAATGGGATGATGAGGTCCCATCACTACTTGCCCTCCTTAAGTAGTGTCG

cg09835024

0016745152

AATAAACACCAACCCCAAACCAATCTCACTTTATTAAATTACAAAAATCA

0081631976

AATAAACGCCGACCCCGAACCGATCTCGCTTTATTAAATTACAAAAATCG

Red

AGCCCCGTCATAGGTGGGCGCCGACCCCGAGCCGATCTCGCTTTATTAAATTACAGAAAT[CG]GTATTCAAAAAAAAAAAAAAAAAAGGGCGGGGAGGACACTCCCTCTTCTCTGTTCCCACA

24072640

GGTGGGCGCCGACCCCGAGCCGATCTCGCTTTATTAAATTACAGAAATCG

cg05451842

0016681196

CRTTCAAATACACTATAACCCRACTAAAAAAACCCCCAACAACCCAAAAC

CACAGCGTGGATGCCCCGATTTCCCAGGTCCCTCCGCAACCCTCAGTAGAACTCCCACCG[CG]CCCTGGGCTGCTGGGGGCCTCCCCAGCCGGGTCACAGTGCACCTGAACGCCCCGGTCCGT

93581139

CGCCCTGGGCTGCTGGGGGCCTCCCCAGCCGGGTCACAGTGCACCTGAAC

cg14797042

0007767973

TTAACAAAATTCAAACCCCTAATATAAACAAATATAATTCTCACTCTAAC

CCATTCAGGTGAGCAGGGCTGTTGCTCAGCAGGTGAGCCTGCCCCGCCATGGAGACTCAG[CG]CTAGAGTGAGAACCACATCTGCTCACACCAGGGGCCTGAACCCTGCTAACCCCACGGGGG

57865112

CCCCCGTGGGGTTAGCAGGGTTCAGGCCCCTGGTGTGAGCAGATGTGGTTCTCACTCTAG[CG]CTGAGTCTCCATGGCGGGGCAGGCTCACCTGCTGAGCAACAGCCCTGCTCACCTGAATGG

cg09838562

0025809572

ACTCRAACTATAAAAACTACACTAAAACAACCTTATCTTAAAACRTAAAC

GACTAGTTTAAACTCGGGCTGTAGAAACTGCACTGAGGCAACCTTGTCTTGGAGCGTGGA[CG]CCTTCCCGGGGCACGTCCGTTTCGGATGCAGCCACAAAGCAAATGGGGTAGAACTTGGAC

15248173

GACTAGTTTAAACTCGGGCTGTAGAAACTGCACTGAGGCAACCTTGTCTTGGAGCGTGGA[CG]CCTTCCCGGGGCACGTCCGTTTCGGATGCAGCCACAAAGCAAATGGGGTAGAACTTGGAC

cg25458538

0051640283

TACTACAACCTCTACAAATTACACACATTATTTAACATCAACCAATTAAC

TCACTCTCGTGTGCTGCAGCCTCTACAAATTGCACACATTGTTTGGCATCAGCCAGTTGG[CG]CTCTTTCTGTCGTACCACCCTCTGGAGCTTCTGTATTTCAAGTTGGCTGCAGAATAAAGC

144921929

GCTTTATTCTGCAGCCAACTTGAAATACAGAAGCTCCAGAGGGTGGTACGACAGAAAGAG[CG]CCAACTGGCTGATGCCAAACAATGTGTGCAATTTGTAGAGGCTGCAGCACACGAGAGTGA

cg14361672

0051800947

ATCACTACCTAATCTATAACAAACCATTCAACCCATCCTAACATCCTACA

0007743487

ATCACTACCTAATCTATAACGAACCATTCAACCCGTCCTAACATCCTACG

Red

TCACCTTCCCACCTCCTGGAGGACGCTCCTCCACGAAGTGCTGACACAACCTCCTGTAAA[CG]CAGGATGCCAGGACGGGCTGAATGGCCCGCCATAGACTAGGCAGTGACCAGCACACCTCC

131463936

CGCAGGATGCCAGGACGGGCTGAATGGCCCGCCATAGACTAGGCAGTGAC

cg01763666

0037768834

AAACAAAAATAAACAAACTCAAAATAAAAACAACTAAACTAAAACAAACA

0023754592

GAACAAAAATAAACGAACTCAAAATAAAAACAACTAAACTAAAACAAACG

Grn

CTGGAATGCCAGCTGCTGCTGCTGCTGCAGCTCCTCCACCTTCCTGGCCTCTCTGGCTAG[CG]CCTGCCTCAGCTTAGCTGCCTCTATCTTGAGCTCGCTCACCTCTGCCCGCCTGGCCTCTT

80159506

CGCCTGCCTCAGCTTAGCTGCCTCTATCTTGAGCTCGCTCACCTCTGCCC

cg09261072

0077677901

AAACRAATATACAAAACACCACTTTAACTCAAACTTCAACTATACCCTAC

TAGATTGACCTGCTAATGAATTGTTTTTGTTTTTACCATCGGATACCAACGTGTTTTTGT[CG]TAGGGTATAGTTGAAGTTTGAGCCAAAGTGGTGCTCTGTATACCCGTCCTCATTTTTCCT

79170388

AGGAAAAATGAGGACGGGTATACAGAGCACCACTTTGGCTCAAACTTCAACTATACCCTA[CG]ACAAAAACACGTTGGTATCCGATGGTAAAAACAAAAACAATTCATTAGCAGGTCAATCTA

cg02404579

0038605549

CTTACRAAAATTTTACAATTACTATTCCTAACCTATAACRTAACCCCTAC

GATCAGAAAATCTTACGAAGATTTTACAGTTACTGTTCCTAGCCTGTGGCGTGACCCCTG[CG]TGCACCGCCTTTTATTCTGAGGGTTGATCCTCATCTAATCTGAACACTCAGATAGAGGCT

2526495

AGCCTCTATCTGAGTGTTCAGATTAGATGAGGATCAACCCTCAGAATAAAAGGCGGTGCA[CG]CAGGGGTCACGCCACAGGCTAGGAACAGTAACTGTAAAATCTTCGTAAGATTTTCTGATC

cg12950382

0008726444

ATACCAAAAAATAACAATATACTTATATATATACACATACCCAAATAACA

0076660327

GTACCGAAAAATAACAATATACTTATATATATACACGTACCCGAATAACG

Red

CCCTGCTGCCACCACCTCGGTGCACACACCTACTGGACGCACAGACACACGCATGCCCAC[CG]CCACTCGGGCACGTGCACACACACAAGCACACTGCCACTCTCCGGCACGCGCACACACAA

105176736

CGCCACTCGGGCACGTGCACACACACAAGCACACTGCCACTCTCCGGCAC

cg02115394

0068602543

AAAATCACTACAACACCTCTAAACATTAACAAAAAAATCAAAAAAACTCA

0059659581

AAAATCGCTACGACGCCTCTAAACATTAACGAAAAAATCAAAAAAACTCG

Red

TTCTGGGGAAAGAAGGCTCAGCAGCCACCTGCTTTTTTGCCCGGGTGGGTGGTCCGGCCC[CG]AGCCCTCCTGACTCTCTCGCCAATGCCCAGAGGCGCCGCAGCGATTCCAGGGAGGCCGCG

115000168

GGAATCGCTGCGGCGCCTCTGGGCATTGGCGAGAGAGTCAGGAGGGCTCG

cg04118974

0063728202

AACTACCCCACAAAACAATCATAAACAATATATAAATTAATAAACATTCC

CAATGATAATCAACCAATTACTTATATAGCTCTTATAATTGTCAGGCATTGTCCCAAGCA[CG]GAATGTTTATTAACCCATACACTGCTCATGACTGTCCTGTGGGGTAGCTATTAGTATTAT

110359535

CAATGATAATCAACCAATTACTTATATAGCTCTTATAATTGTCAGGCATTGTCCCAAGCA[CG]GAATGTTTATTAACCCATACACTGCTCATGACTGTCCTGTGGGGTAGCTATTAGTATTAT

cg01236347

0013630234

CAAAATTTCTACTACTACTTCTTCTTTTCTTTTTTTAAAAACAAACTCTC

TGAGGCAGAGGTTGCAGTGAGCCAAGATTGTGTCATTGCACTCCAGCCTGGGCAACAGAG[CG]AGAGTCTGTCTCCAAAAAAAGAAAAGAAGAAGCAGCAGCAGAAACTCTGCCTGATACAGA

101854174

TCTGTATCAGGCAGAGTTTCTGCTGCTGCTTCTTCTTTTCTTTTTTTGGAGACAGACTCT[CG]CTCTGTTGCCCAGGCTGGAGTGCAATGACACAATCTTGGCTCACTGCAACCTCTGCCTCA

cg22585117

0023618586

TAAATAAACAAACTCTAAAATCAAAATACTTATATTCAAATTCTAACCCC

TTGAAAGTCATGACACAAAGAGGCTATTTTACATGCTCAAGGGTATTGGCTAGTAAATGA[CG]GGGTCAGAATTTGAATACAAGCACTTTGACTTTAGAGCCTGTCCATTCAACAACTACTCA

124134126

TTGAAAGTCATGACACAAAGAGGCTATTTTACATGCTCAAGGGTATTGGCTAGTAAATGA[CG]GGGTCAGAATTTGAATACAAGCACTTTGACTTTAGAGCCTGTCCATTCAACAACTACTCA

cg25552317

0039755987

CCTAACATTTTAACTTCCACTATTTAAAAATATTACACCTTTCTTTTTTC

AGGCTTACACGCCTGGCATTTTAACTTCCACTGTTTGAAAGTATTACACCTTTCTTTTTT[CG]CACTCCCTCACAGTTCTAAAAAGCTCTGAACTCATTTCGTTCTTCTTTTCTTCCCTTGTC

92379065

CTGGCATTTTAACTTCCACTGTTTGAAAGTATTACACCTTTCTTTTTTCG

cg23875663

0053703202

AACAAAAACAAACTTCAAAAAAACCTAACAAAACTTTAACATTCATAAAC

TGGCTGGTGTTCTTTCATCTCCACGGGGCATTCCACCCAACAATCACCATCTGCCAGGGA[CG]CCTATGAATGTCAAAGTTCTGCTAGGTTTCTCTGAAGCCTGCTTCTGCTTTCAGCAGCTT

17299350

CGCCTATGAATGTCAAAGTTCTGCTAGGTTTCTCTGAAGCCTGCTTCTGC