NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL2005 Query DataSets for GPL2005
Status Public on Apr 28, 2005
Title [Mapping50K_Xba240] Affymetrix Human Mapping 50K Xba240 SNP Array
Technology type in situ oligonucleotide
Distribution commercial
Organism Homo sapiens
Manufacturer Affymetrix
Manufacture protocol see manufacturer's web site
 
Description Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html

The GeneChip® Mapping 100K Set is the first in a family of products for whole-genome association studies. It is comprised of a set of two arrays that enable genotyping of greater than 100,000 SNPs with a single primer.

copy number analysis
mean marker distance of 26 kb
provides both copy number and allele specific information

 
Web link http://www.affymetrix.com/support/technical/byproduct.affx?product=100k
http://www.affymetrix.com/analysis/index.affx
Submission date Apr 28, 2005
Last update date Dec 22, 2017
Organization Affymetrix, Inc.
E-mail geo@ncbi.nlm.nih.gov, support@affymetrix.com
Phone 888-362-2447
URL http://www.affymetrix.com/index.affx
Street address
City Santa Clara
State/province CA
ZIP/Postal code 95051
Country USA
 
Samples (4969) GSM127290, GSM127291, GSM127292, GSM127293, GSM127294, GSM127295 
Series (75)
GSE5511 Genes regulating B cell development are mutated in acute lymphoid leukaemia
GSE5927 SNP expression data from breast cancer
GSE6109 High-resolution Global Genomic Survey of 178 Gliomas

Data table header descriptions
ID
dbSNP RS ID refSNP ID
Chromosome
Genome Version
DB SNP Version
Physical Position
Strand
ChrX pseudo-autosomal region
Cytoband
SEQUENCE
Allele A
Allele B
Associated Gene
Genetic Map
Microsatellite
Fragment Length Start Stop
Freq Asian
Freq AfAm
Freq Cauc
Het Asian
Het AfAm
Het Cauc
Num chrm Asian
Num chrm AfAm
Num chrm Cauc
SPOT_ID controls

Data table
ID dbSNP RS ID Chromosome Genome Version DB SNP Version Physical Position Strand ChrX pseudo-autosomal region Cytoband SEQUENCE Allele A Allele B Associated Gene Genetic Map Microsatellite Fragment Length Start Stop Freq Asian Freq AfAm Freq Cauc Het Asian Het AfAm Het Cauc Num chrm Asian Num chrm AfAm Num chrm Cauc SPOT_ID
SNP_A-1643131 rs7546903 1 NCBI Build 35, May 2004 123, October 2004 6870538 - FALSE p36.31 gagaaaacaaggaaagagggaacta[C/T]gaaggagaagaaaagaagggaacga C T ENST00000303646 // intron // 0 // --- // --- // --- // --- 12.0411014232682 // D1S2642 // D1S1646 // --- // --- /// 13.9764876493177 // D1S2633 // D1S214 // AFMA131YA5 // AFM147YF8 /// 13.3144527125093 // D1S2870 // D1S2694 // --- // --- D1S214 // upstream // 25717 /// D1S2642 // downstream // 85884 1340 // 6870139 // 6871478 0.6341 0.439 0.3415 0.464 0.4926 0.4497 84 84 84
SNP_A-1708186 rs3845520 1 NCBI Build 35, May 2004 123, October 2004 23047249 - FALSE p36.12 gattctcaaccttggccacacagtc[A/G]aatcaccaaggagtcttcaaaggct A G NM_004442 // downstream // 60861 // Hs.523329 // EPHB2 // 2048 // Homo sapiens EphB2 (EPHB2), transcript variant 2, mRNA. /// NM_017449 // downstream // 60861 // Hs.523329 // EPHB2 // 2048 // Homo sapiens EphB2 (EPHB2), transcript variant 1, mRNA. /// NM_015013 // upstream // 44043 // Hs.257900 // AOF2 // 23028 // Homo sapiens amine oxidase (flavin containing) domain 2 (AOF2), mRNA. /// ENST00000255580 // downstream // 60861 // --- // --- // --- // --- /// ENST00000356634 // upstream // 44043 // --- // --- // --- // --- /// ENST00000246149 // upstream // 44045 // --- // --- // --- // --- 42.3866031153443 // D1S2864 // D1S458 // --- // --- /// 50.9157448376161 // D1S1539 // D1S2620 // UT5123 // AFMA114YD5 /// 44.0773985998703 // D1S2864 // D1S2838 // --- // --- D1S1318 // upstream // 29363 /// D1S2698 // downstream // 33239 503 // 23047060 // 23047562 0.8214 0.619 0.8333 0.2934 0.4717 0.2778 84 84 84
SNP_A-1679806 rs301801 1 NCBI Build 35, May 2004 123, October 2004 8430211 - FALSE p36.23 cattgatgcatgctttctgatattc[A/G]cccagtggcagtactttttgttggg A G NM_012102 // intron // 0 // Hs.463041 // RERE // 473 // Homo sapiens arginine-glutamic acid dipeptide (RE) repeats (RERE), mRNA. /// ENST00000337907 // intron // 0 // --- // --- // --- // --- /// ENST00000326676 // intron // 0 // --- // --- // --- // --- 14.3176440660504 // D1S1612 // D1S503 // --- // --- /// 16.8842129949185 // D1S1612 // D1S2736 // GGAA3A07 // AFMB049WE9 /// 14.9841643698722 // D1S1612 // D1S2736 // --- // --- D1S1615 // upstream // 73360 /// D1S3372 // downstream // 83480 732 // 8430139 // 8430870 0.8929 0.7024 0.7262 0.1913 0.4181 0.3977 84 84 84
SNP_A-1687400 rs172531 1 NCBI Build 35, May 2004 123, October 2004 8429856 - FALSE p36.23 ctctagtgggtttgaacgaagaaca[C/T]ctaatggttttgtcagtagtagtta C T NM_012102 // intron // 0 // Hs.463041 // RERE // 473 // Homo sapiens arginine-glutamic acid dipeptide (RE) repeats (RERE), mRNA. /// ENST00000337907 // intron // 0 // --- // --- // --- // --- /// ENST00000326676 // intron // 0 // --- // --- // --- // --- 14.3171765819515 // D1S1612 // D1S503 // --- // --- /// 16.8835890368838 // D1S1612 // D1S2736 // GGAA3A07 // AFMB049WE9 /// 14.9837095485258 // D1S1612 // D1S2736 // --- // --- D1S1615 // upstream // 73715 /// D1S3372 // downstream // 83125 1321 // 8428819 // 8430139 0.1071 0.2976 0.2738 0.1913 0.4181 0.3977 84 84 84
SNP_A-1701699 rs10493001 1 NCBI Build 35, May 2004 123, October 2004 20846222 + FALSE p36.12 attccacagaccttagctatactta[G/T]gaaactcagataaagaataccctga G T NM_016287 // intron // 0 // Hs.142442 // HP1-BP74 // 50809 // Homo sapiens HP1-BP74 (HP1-BP74), mRNA. /// ENST00000360142 // intron // 0 // --- // --- // --- // --- /// ENST00000312239 // intron // 0 // --- // --- // --- // --- 39.5028573742055 // D1S2732 // D1S478 // --- // --- /// 46.8669896552048 // UNKNOWN // D1S1539 // ATA47D07 // UT5123 /// 41.2326733486209 // --- // --- // 44838 // 548760 D1S1269 // upstream // 189950 /// D1S3535 // downstream // 122236 1714 // 20845448 // 20847161 0.1786 0.0119 0.0119 0.2934 0.0235 0.0235 84 84 84
SNP_A-1693280 rs2870448 1 NCBI Build 35, May 2004 123, October 2004 22270247 - FALSE p36.12 tctagaaaaggcataactatgaaga[C/T]aagaaaaagatcagtggtttccagg C T NM_030761 // upstream // 55490 // Hs.302428 // WNT4 // 54361 // Homo sapiens wingless-type MMTV integration site family, member 4 (WNT4), mRNA. /// ENST00000290167 // upstream // 55490 // --- // --- // --- // --- /// ENST00000354898 // downstream // 124401 // --- // --- // --- // --- 40.9685800011843 // D1S2725 // D1S2864 // --- // --- /// 48.803550736375 // UNKNOWN // D1S1539 // ATA47D07 // UT5123 /// 42.4655481114752 // --- // D1S2702 // 548760 // --- D1S1377 // upstream // 10040 /// D1S2436 // downstream // 22801 409 // 22269859 // 22270267 0.9881 0.9167 1 0.0235 0.1528 0 84 84 84
SNP_A-1734642 rs10492931 1 NCBI Build 35, May 2004 123, October 2004 5157728 - FALSE p36.32 ttcatctacaggctccaatatccta[C/T]ggtttctcccaacacctgggaaatt C T NM_018836 // downstream // 403505 // Hs.25924 // SHREW1 // 55966 // Homo sapiens transmembrane protein SHREW1 (SHREW1), mRNA. /// ENST00000359090 // downstream // 403505 // --- // --- // --- // --- /// ENST00000354985 // downstream // 403505 // --- // --- // --- // --- /// ENST00000253998 // downstream // 699409 // --- // --- // --- // --- 8.29616354742266 // D1S2132 // D1S2633 // --- // --- /// 10.9055698861906 // UNKNOWN // D1S2633 // GATA68D01 // AFMA131YA5 /// 11.2562570062893 // D1S2660 // --- // --- // 609730 D1S385 // upstream // 91760 /// D1S2132 // downstream // 111375 1439 // 5157208 // 5158646 0.4881 0.4405 0.5595 0.4997 0.4929 0.4929 84 84 84
SNP_A-1705081 rs2807562 1 NCBI Build 35, May 2004 123, October 2004 14979335 - FALSE p36.21 ttaggcatccaagggtcttcgggca[C/T]tatttcagaaggcgtctcaagctct C T ENST00000251295 // intron // 0 // --- // --- // --- // --- 27.0648534490766 // D1S2728 // D1S2672 // --- // --- /// 33.5997541768806 // D1S2834 // D1S2672 // AFM321ZB9 // AFMA232ZB9 /// 29.6746587603491 // --- // D1S2672 // 815107 // --- D1S2672 // upstream // 44626 /// D1S3472 // downstream // 33088 1351 // 14978526 // 14979876 0.881 0.5 0.7857 0.2098 0.5 0.3367 84 84 84
SNP_A-1748913 rs9434845 1 NCBI Build 35, May 2004 123, October 2004 7112079 + FALSE p36.23 aaaaatcagcatatctcagccataa[C/T]tggtcttcactcagccaccagctcc C T ENST00000303646 // intron // 0 // --- // --- // --- // --- 12.3543335938178 // D1S1646 // D1S2663 // --- // --- /// 14.4413029679655 // D1S214 // D1S2663 // AFM147YF8 // AFMA210XG9 /// 13.5440310728852 // D1S2870 // D1S2694 // --- // --- D1S1398 // upstream // 41223 /// D1S1192 // downstream // 35317 1651 // 7110850 // 7112500 0.2927 0.2262 0.3333 0.414 0.3501 0.4444 84 84 84
SNP_A-1659730 rs1009806 1 NCBI Build 35, May 2004 123, October 2004 19245857 - FALSE p36.13 cccccaagtgctatatctcctgtca[A/G]tactggttgatgtgtgatattgaaa A G NM_020765 // intron // 0 // Hs.148078 // RBAF600 // 23352 // Homo sapiens retinoblastoma-associated factor 600 (RBAF600), mRNA. /// ENST00000248008 // intron // 0 // --- // --- // --- // --- 37.3608984168349 // D1S552 // D1S199 // --- // --- /// 44.5400490415246 // D1S2644 // D1S199 // AFMA153XE9 // AFM078YG5 /// 39.5663030313582 // --- // --- // 613868 // 64451 D1S378 // upstream // 13786 /// D1S1405 // downstream // 74947 1299 // 19245778 // 19247076 0.4881 0.9048 0.6786 0.4997 0.1723 0.4362 84 84 84
SNP_A-1755914 rs10489536 1 NCBI Build 35, May 2004 123, October 2004 6314553 + FALSE p36.31 ctgtaaatagcttgtcacataggac[A/G]ggatccgaaaaggagagttttgtgt A G NM_181866 // intron // 0 // Hs.126137 // BACH // 11332 // Homo sapiens brain acyl-CoA hydrolase (BACH), transcript variant hBACHd, mRNA. /// NM_181865 // intron // 0 // Hs.126137 // BACH // 11332 // Homo sapiens brain acyl-CoA hydrolase (BACH), transcript variant hBACHc, mRNA. /// NM_181864 // intron // 0 // Hs.126137 // BACH // 11332 // Homo sapiens brain acyl-CoA hydrolase (BACH), transcript variant hBACHb, mRNA. /// NM_181862 // intron // 0 // Hs.126137 // BACH // 11332 // Homo sapiens brain acyl-CoA hydrolase (BACH), transcript variant hBACHa/X, mRNA. /// NM_007274 // intron // 0 // Hs.126137 // BACH // 11332 // Homo sapiens brain acyl-CoA hydrolase (BACH), transcript variant hBACHa, mRNA. /// ENST00000344869 // intron // 0 // --- // --- // --- // --- /// ENST00000308067 // intron // 0 // --- // --- // --- // --- /// ENST00000270694 // intron // 0 // --- // --- // --- // --- /// ENST00000262448 // intron // 0 // --- // --- // --- // --- /// ENST00000335808 // intron // 0 // --- // --- // --- // --- 11.4716607429785 // D1S2870 // D1S2642 // --- // --- /// 12.6126193439573 // D1S2633 // D1S214 // AFMA131YA5 // AFM147YF8 /// 12.786003609899 // D1S2870 // D1S2694 // --- // --- D1S3100 // upstream // 77367 /// D1S1250 // downstream // 6973 1459 // 6313508 // 6314966 0.0952 0.2262 0.0714 0.1723 0.3501 0.1327 84 84 84
SNP_A-1681384 rs1109251 1 NCBI Build 35, May 2004 123, October 2004 2996733 + FALSE p36.32 aaagatactgacatccaaggatcaa[A/G]gatcactcccattcatgggtctcaa A G NM_198543 // downstream // 7060 // --- // --- // 0 // --- /// NM_199454 // upstream // 12168 // Hs.99500 // PRDM16 // 63976 // Homo sapiens PR domain containing 16 (PRDM16), transcript variant 2, mRNA. /// NM_022114 // upstream // 12168 // Hs.99500 // PRDM16 // 63976 // Homo sapiens PR domain containing 16 (PRDM16), transcript variant 1, mRNA. /// NM_080431 // downstream // 34111 // Hs.236635 // ARPM2 // 140625 // Homo sapiens actin-related protein M2 (ARPM2), mRNA. /// ENST00000321336 // downstream // 7060 // --- // --- // --- // --- /// ENST00000356561 // downstream // 8493 // --- // --- // --- // --- /// ENST00000270722 // upstream // 12168 // --- // --- // --- // --- /// ENST00000356607 // downstream // 145300 // --- // --- // --- // --- /// ENST00000304706 // downstream // 34111 // --- // --- // --- // --- 3.32215447182637 // --- // D1S468 // --- // --- /// 3.50487296777682 // --- // D1S468 // --- // AFM280WE5 /// 3.15055849592067 // --- // --- // --- // 42051 D1S3023 // upstream // 2606 /// D1S97 // downstream // 120176 1459 // 2996334 // 2997792 0.0119 0.0119 0.131 0.0235 0.0235 0.2276 84 84 84
SNP_A-1728267 rs951908 1 NCBI Build 35, May 2004 123, October 2004 19245141 + FALSE p36.13 cagcaagaaaaagtgtttaggagat[C/G]actataggcaaagctttcattatct C G NM_020765 // intron // 0 // Hs.148078 // RBAF600 // 23352 // Homo sapiens retinoblastoma-associated factor 600 (RBAF600), mRNA. /// ENST00000248008 // intron // 0 // --- // --- // --- // --- 37.360711619878 // D1S552 // D1S199 // --- // --- /// 44.5388100954821 // D1S2644 // D1S199 // AFMA153XE9 // AFM078YG5 /// 39.5652901483306 // --- // --- // 613868 // 64451 D1S378 // upstream // 14502 /// D1S1405 // downstream // 74231 525 // 19245054 // 19245578 0.75 0.7857 0.5952 0.375 0.3367 0.4819 84 84 84
SNP_A-1708763 rs3767237 1 NCBI Build 35, May 2004 123, October 2004 20844997 + FALSE p36.12 cttcaaataaaaactgtacttaatc[A/G]ataaactgcatttaaaaattctaaa A G NM_016287 // intron // 0 // Hs.142442 // HP1-BP74 // 50809 // Homo sapiens HP1-BP74 (HP1-BP74), mRNA. /// ENST00000360142 // intron // 0 // --- // --- // --- // --- /// ENST00000312239 // intron // 0 // --- // --- // --- // --- 39.5016365669155 // D1S2732 // D1S478 // --- // --- /// 46.8653237523419 // UNKNOWN // D1S1539 // ATA47D07 // UT5123 /// 41.231954911471 // --- // --- // 44838 // 548760 D1S1269 // upstream // 191175 /// D1S3535 // downstream // 121011 888 // 20844280 // 20845167 0.2381 0.0238 0.1071 0.3628 0.0465 0.1913 84 84 84
SNP_A-1719311 rs1934489 1 NCBI Build 35, May 2004 123, October 2004 14558299 - FALSE p36.21 gagtaacatacaacggtagagtaat[A/G]aactatgatgctaaattttcattat A G NM_015866 // downstream // 698424 // Hs.371823 // PRDM2 // 7799 // Homo sapiens PR domain containing 2, with ZNF domain (PRDM2), transcript variant 2, mRNA. /// NM_012231 // downstream // 661418 // Hs.371823 // PRDM2 // 7799 // Homo sapiens PR domain containing 2, with ZNF domain (PRDM2), transcript variant 1, mRNA. /// NM_015866 // downstream // 661418 // Hs.371823 // PRDM2 // 7799 // Homo sapiens PR domain containing 2, with ZNF domain (PRDM2), transcript variant 2, mRNA. /// NM_201628 // upstream // 612532 // Hs.531424 // FLJ43806 // 399563 // Homo sapiens hypothetical protein FLJ43806 (FLJ43806), mRNA. /// NM_182534 // downstream // 629456 // Hs.447976 // FLJ23703 // 200197 // Homo sapiens hypothetical protein FLJ23703 (FLJ23703), mRNA. /// ENST00000311066 // downstream // 698424 // --- // --- // --- // --- /// ENST00000235372 // downstream // 661418 // --- // --- // --- // --- /// ENST00000343137 // downstream // 698424 // --- // --- // --- // --- /// ENST00000251295 // upstream // 112207 // --- // --- // --- // --- /// ENST00000303864 // upstream // 437633 // --- // --- // --- // --- /// ENST00000316575 // downstream // 579136 // --- // --- // --- // --- /// ENST00000338894 // upstream // 612532 // --- // --- // --- // --- /// ENST00000361061 // upstream // 623490 // --- // --- // --- // --- /// ENST00000310916 // downstream // 629456 // --- // --- // --- // --- 25.7273752824521 // D1S2834 // D1S507 // --- // --- /// 32.1881032712553 // D1S2834 // D1S2672 // AFM321ZB9 // AFMA232ZB9 /// 28.4970015663459 // --- // D1S2672 // 815107 // --- D1S407 // upstream // 41136 /// D1S1389 // downstream // 15935 605 // 14558230 // 14558834 0.4405 0.2262 0.3452 0.4929 0.3501 0.4521 84 84 84
SNP_A-1741675 rs1107087 1 NCBI Build 35, May 2004 123, October 2004 20346366 - FALSE p36.12 gcttagctagcattatctcaataaa[A/G]actttacaagaatctcacaagggag A G NM_152376 // downstream // 78519 // Hs.432503 // UBXD3 // 127733 // Homo sapiens UBX domain containing 3 (UBXD3), mRNA. /// NM_144623 // upstream // 58348 // Hs.205178 // FLJ32784 // 127731 // Homo sapiens hypothetical protein FLJ32784 (FLJ32784), mRNA. /// ENST00000294544 // downstream // 78519 // --- // --- // --- // --- /// ENST00000289815 // upstream // 16370 // --- // --- // --- // --- /// ENST00000289825 // upstream // 58348 // --- // --- // --- // --- 38.9586954902656 // D1S199 // D1S2732 // --- // --- /// 46.1932637322358 // D1S199 // UNKNOWN // AFM078YG5 // ATA47D07 /// 40.9395181486021 // --- // --- // 44838 // 548760 D1S1442 // upstream // 1135 /// D1S2843 // downstream // 90680 1399 // 20345117 // 20346515 0.75 0.9524 0.7024 0.375 0.0907 0.4181 84 84 84
SNP_A-1686722 rs3912752 1 NCBI Build 35, May 2004 123, October 2004 4287405 + FALSE p36.32 gtcaaggggttctgtacttctgtag[C/T]cattactttggaatgggctattcca C T NM_018836 // upstream // 338073 // Hs.25924 // SHREW1 // 55966 // Homo sapiens transmembrane protein SHREW1 (SHREW1), mRNA. /// ENST00000356772 // upstream // 324142 // --- // --- // --- // --- /// ENST00000360071 // upstream // 316133 // --- // --- // --- // --- /// ENST00000359090 // upstream // 338073 // --- // --- // --- // --- /// ENST00000354985 // upstream // 338073 // --- // --- // --- // --- 5.84631680036154 // D1S468 // D1S2893 // --- // --- /// 8.35360798169274 // D1S468 // D1S2845 // AFM280WE5 // AFM344WE9 /// 8.94970918425691 // D1S468 // D1S2845 // --- // --- D1S2845 // upstream // 81369 /// D15S1313 // downstream // 97319 1217 // 4286695 // 4287911 0.9405 0.8571 0.8333 0.112 0.2449 0.2778 84 84 84
SNP_A-1717655 rs6659639 1 NCBI Build 35, May 2004 123, October 2004 15185462 + FALSE p36.21 cacttgctatgtgctttgcagatgg[A/G]acttgacttttttttttttgagaca A G NM_201628 // intron // 0 // Hs.531424 // FLJ43806 // 399563 // Homo sapiens hypothetical protein FLJ43806 (FLJ43806), mRNA. /// ENST00000316575 // intron // 0 // --- // --- // --- // --- /// ENST00000338894 // intron // 0 // --- // --- // --- // --- 27.5074789070764 // D1S2672 // D1S1592 // --- // --- /// 33.962517904792 // D1S2672 // D1S3669 // AFMA232ZB9 // GATA29A05 /// 32.1364613954914 // --- // D1S1592 // 15353 // --- D1S1352 // upstream // 33229 /// D1S1356 // downstream // 99368 855 // 15185007 // 15185861 0.3095 0.2317 0.25 0.4274 0.356 0.375 84 84 84
SNP_A-1704403 rs639802 1 NCBI Build 35, May 2004 123, October 2004 23351307 - FALSE p36.12 tggagcatgcacacaaatgatttaa[G/T]acattgtagtgcatgttgggataga G T NM_000864 // upstream // 85289 // Hs.121482 // HTR1D // 3352 // Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1D (HTR1D), mRNA. /// NM_005826 // downstream // 30276 // Hs.373763 // HNRPR // 10236 // Homo sapiens heterogeneous nuclear ribonucleoprotein R (HNRPR), mRNA. /// ENST00000314113 // upstream // 85289 // --- // --- // --- // --- /// ENST00000302271 // downstream // 30276 // --- // --- // --- // --- 42.8175127303418 // D1S458 // D1S2620 // --- // --- /// 51.8815691826816 // D1S1539 // D1S2620 // UT5123 // AFMA114YD5 /// 44.4158092836755 // D1S2864 // D1S2838 // --- // --- D1S3597 // upstream // 80466 /// D1S2541 // downstream // 96461 503 // 23351186 // 23351688 0 0.1667 0 0 0.2778 0 84 84 84
SNP_A-1672258 NCBI Build 35, May 2004 123, October 2004 aagctgtgctgaagggacttgatac[A/G]ctgctggcccagaagcttcgcccca A G 0.9048 1 0.9881 0.1723 0 0.0235 84 84 84

Total number of rows: 59015

Table truncated, full table size 52922 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap