NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL18472 Query DataSets for GPL18472
Status Public on Dec 04, 2014
Title Mycroarray Legionella pneumophila Philadelphia-1 genome array (including smallRNAs)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Manufacturer Mycroarray
Manufacture protocol Proprietary Light Directed Oligonucleotide Synthesis, 50-mer, on glass slide.
 
Description CUST-3x20K-110928-Faucher
Legionella pneumophila Philadelphia-1 genome, including predicted sRNA (Faucher 2010 PNAS) and sRNA found by RNA-seq (Weissenmayer, 2011 Plos ONE)
 
Submission date Mar 26, 2014
Last update date Dec 04, 2014
Contact name Sebastien Faucher
E-mail(s) sebastien.faucher@gmail.com
Phone 514-398-7886
Organization name McGill University
Department Natural Resource Sciences
Lab Faucher
Street address 21,111 Lakeshore
City St-Anne-de-Bellevue
State/province QC
ZIP/Postal code H9X 3V9
Country Canada
 
Samples (12) GSM1357781, GSM1357782, GSM1357783, GSM1357784, GSM1357785, GSM1357786 
Series (1)
GSE56258 Transcriptome of Legionella pneumophila rpoS mutant in water

Data table header descriptions
ID Unique identifier. psRNA refer to smallRNA (sRNA) identified in Faucher 2010 PNAS, weiss refer to sRNA identified in Weissenmayer, 2011 Plos ONE.
ORF ORF Name
PT_LIST Protein accession number(s)
SEQUENCE Probe sequence
SPOT_ID

Data table
ID ORF PT_LIST SEQUENCE SPOT_ID
lpg0001 lpg0001 YP_094056.1 AGTCATACATGCTTGTCGGAAGGTTAAAGAATTAATCCAGGATGA
lpg0002 lpg0002 YP_094057.1 TTCTGAAGGTCAAATCAGGTTATCAATGTCTAATACTGAAAGCAG
lpg0003 lpg0003 YP_094058.1 ATTAACAACAATAATTACGATATCCTGCCAATTGACTCAGGTTTG
lpg0004 lpg0004 YP_094059.1 GAAGAGATTTTATTGAAACGAATGCTTTAGACGCTGAAAACATTG
lpg0005 lpg0005 YP_094060.1 TCAAATTACACAAATTGATGCACTCGATGTATTTTCTGGTGGTGG
lpg0006 lpg0006 YP_094061.1 AGCTTTCTGATGATGGACAATTTGAGCTGGATGATTTAGTCAGCG
lpg0007 lpg0007 YP_094062.1 ACAACGAGAGCCTGAAACTTATCATGAATTAGTCAAATCCCGTTA
lpg0008 lpg0008 YP_094063.1 AAGAGAAACAGAATTGCTGGACTAGTTTTTGTGGGTTATTTGGCA
lpg0009 lpg0009 YP_094064.1 TTTCAACAGTTGTTCCTTCTCGAATGGTCAAAATTCCTGCTGAGG
lpg0010 lpg0010 YP_094065.1 AGATGAAAACGGCGATTGGTTAATGAAAATTAGAATAACGGCTGAT
lpg0011 lpg0011 YP_094066.1 GCAAGCTGGTGTGAAACCTGTGTCGATGAAATCCCTGAATTTAAT
lpg0012 lpg0012 YP_094067.1 TTAAAGAAACACAGTATTTTGGCAGCAAAACAAACCCATTCGGCC
lpg0013 lpg0013 YP_094068.1 GAAGAAATTATGCAGGCAATACATGATTTTCGTACAGGACATTTT
lpg0014 lpg0014 YP_094069.1 GTTCAAGAATAGTAAAAGCGGCTTCGAAGGATTACAACTTTGGCC
lpg0015 lpg0015 YP_094070.1 AGAGTCAAATTCAGGTTGTTACAAATCAAAATGAATGGCTGTTGC
lpg0016 lpg0016 YP_094071.1 GCCTGCATTTAAAGAAACGCATGAGTTGGAAATTTTGTATCAATT
lpg0017 lpg0017 YP_094072.1 TTTGTTGCAGGGGAGCAAACAATTGATCTTAGTGAGGGAGTAAAG
lpg0018 lpg0018 YP_094073.1 AGGTTATCGCGCCAATTTAGAGTCTGAAATAAAGTCTTCTGTCTG
lpg0019 lpg0019 YP_094074.1 ATAAGGTTAAGTCCGCTTTTGGTCAAGTAGGTATTGATACAGCCG
lpg0020 lpg0020 YP_094075.1 AAGACCTGTCAAACAATACGTCCAATCATCTGTTAAACTTGCGGC

Total number of rows: 3172

Table truncated, full table size 233 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap