NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL1637 Query DataSets for GPL1637
Status Public on Oct 29, 2004
Title Human 36mer genome tiling array HS_25100
Technology type in situ oligonucleotide
Distribution non-commercial
Organism Homo sapiens
 
Description Maskless photolithographic synthesis oligonucleotide array on glass
This series of microarrays is designed to represent sense and antisense strands of the nonrepetitive DNA of the human genome with 36mer oligonucleotide probes, positioned every 46nt on average. The probes were selected from the November 14, 2002 human genome sequence assembly (NCBI Build 31/hg13).
Microarrays were constructed with Expedite DNA synthesizers (Applied Biosystems, Foster City, CA) in conjunction with Maskless Array Synthesis (MAS) units (NimbleGen Systems, Madison, WI).
Arrays containing approximately 390,000 oligonucleotide features in a 14 × 17.4 mm square area were fabricated with photolabile phosophoramidites (NPPOC-dAdenosine (N6-tac) -Cyanoethylphosphoramidite, NPPOC-dCytidine (N4-Isobutyryl) -Cyanoethylphosphoramidite NPPOC-dGuanosine (N2-ipac) -Cyanoethylphosphoramidite, NPPOC-dThymidine-Cyanoethylphosphoramidite) obtained from Proligo (Boulder, CO). Following MAS synthesis, base-protecting groups were removed in a solution of ethylenediamine:ethanol (1:1 v/v) (Aldrich, St. Louis, MO) for 2 hours. The arrays were rinsed with water, dried and stored desiccated until use.
Keywords = genomic tiling, maskless photolithography
 
Web link http://transcriptome.gersteinlab.org
Contributor(s) Bertone P
Submission date Oct 29, 2004
Last update date Oct 28, 2005
Contact name Paul Bertone
E-mail(s) paul.bertone@yale.edu
Phone (203) 432-5405
Organization name Yale University
Street address
City New Haven
State/province CT
ZIP/Postal code 06520
Country USA
 
Samples (1) GSM34177
Series (1)
GSE1904 Maskless photolithography genome tiling experiment

Data table header descriptions
ID
X X coordinate of the array feature
Y Y coordinate of the array feature
CHROMOSOME Chromosome from which the oligonucleotide sequence was selected
POSITION Chromosome start position of the oligonucleotide relative to NCBI Build 31, Nov. 14, 2002 (hg13)
STRAND Sense or antisense strand of the chromosome sequence represented by the oligonucleotide probe
SEQUENCE DNA sequence of the oligonucleotide
FREQUENCY Oligomer frequency information calculated to determine the uniqueness of every 36mer subsequence in the genome. This measure was used to select probes that occur fewer than 5 times on average to reduce the potential for cross-hybridization.

Data table
ID X Y CHROMOSOME POSITION STRAND SEQUENCE FREQUENCY
1.1 1 1 X 22302965 - CTTTATATGCCACGCTAACAGGATTAGCCCAGGTGC 1.05
1.3 1 3 X 2335653 - GCAACCCAAGCTCAGATGTTATTGTCAATGCTGAAA 1.3
1.5 1 5 X 25132027 - CCATTTTGAAGTACTTTTCAATGTTATGGATTTCTC 1.8
1.7 1 7 Y 6207342 - CCACGGAGATGGCCCAAAGGGGTGTTGAGGTTGATA 2.55
1.9 1 9 X 9491645 - TTAAAAATGTGTCTATTCATAACGGAGCTATAAATT 1.25
1.11 1 11 X 8485738 - GAGCTAAACAGCAAACTTCTGGTCCAGCCTCTGCAT 1.5
1.13 1 13 X 12523840 - ATCCTTAATCCATATATCACCAGTGAGCAAATTTCA 1.3
1.15 1 15 Y 9659833 - AACATGATCCAGGCCCCTTCCCACAAAACCCTCTCT 2.35
1.17 1 17 Y 13588241 - TTATTGTGAGACTTGAGACACAGTTCATTCTAGTTA 1.5
1.19 1 19 X 1110994 - AGGGCAGCCCAGCACACAGCACGCCCTTAGGCGGGA 3.85
1.21 1 21 Y 8865145 - CTGCACCTCCAAGCTGCTCCTACAACTCATGATCTA 3
1.23 1 23 Y 5047776 - TGGGCTTAAATTTACATTCTGTATTGTTTCCTTTGG 3.45
1.25 1 25 Y 13955260 - AATGACCACAGAAGCCCTCTTGCAGCTGAGAGTCCT 1.15
1.27 1 27 X 20957287 - AGTCATTAATCCAATGCCAGATGGTATCCTGGGAGA 1.15
1.29 1 29 X 9003728 - GGGAAAAGGTTAGGGAAAATGTACAGCAAGGCTTGC 1.35
1.31 1 31 Y 27829939 - TGTTGCTGTAGAAACAGGGATGATGACAGTGATGAT 4.15
1.33 1 33 X 24197070 - CAGTCCTAGCCAATGTTCCTTCCTAGACATTTTGCC 1.35
1.35 1 35 Y 16437179 - CGCTGTAAACACATATTATTTTATACTTTGGAGTAA 1.85
1.37 1 37 Y 15637752 - CACATCTGTTCCAGAATCGTTTGGTAATTAATTTTG 1.3
1.39 1 39 Y 17604481 - CTCTAAATTTTACTCAAATAAGGAAAACGTTACCAT 2.7

Total number of rows: 389668

Table truncated, full table size 26470 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap