NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15867 Query DataSets for GPL15867
Status Public on Jul 31, 2012
Title Agilent-027432 Syn6803_expressions454_4-3probes
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Synechocystis sp. PCC 6803
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description 4 probes per feature on chr except for internals; otherwise 3 probes per feature; done on 454 data with new annotation

Arrays of this design have barcodes that begin with 16027432 or 2527432.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

 
Submission date Jul 30, 2012
Last update date Jan 23, 2017
Contact name Jens Georg
E-mail jens.georg@biologie.uni-freiburg.de
Organization name University of Freiburg
Street address Schänzlestr. 1
City Freiburg
ZIP/Postal code 79104
Country Germany
 
Samples (256) GSM979518, GSM979519, GSM979520, GSM979521, GSM979522, GSM979523 
Series (17)
GSE39804 Inference of pathways, non-coding RNAs and regulatory elements during iron deprivation of Synechocystis based on comprehensive expression profiling
GSE41411 The small RNA PsrR1 affects oligomerization of photosystem I by post-transcriptional repression of psaL in Synechocystis sp. PCC6803
GSE45667 How cyanobacteria pose new problems to old methods: Challenges in microarray time series analysis

Data table header descriptions
ID Agilent feature number
COL Column
ROW Row
NAME NAME
SPOT_ID Spot identifier
CONTROL_TYPE Control type
ACCESSION_STRING Accession String
ORF ORF Name
CHROMOSOMAL_LOCATION Chromosomal Location
SEQUENCE Sequence

Data table
ID COL ROW NAME SPOT_ID CONTROL_TYPE ACCESSION_STRING ORF CHROMOSOMAL_LOCATION SEQUENCE
1 266 170 GE_BrightCorner GE_BrightCorner pos
2 266 168 DarkCorner DarkCorner pos
3 266 166 DarkCorner DarkCorner pos
4 266 164 DarkCorner DarkCorner pos
5 266 162 DarkCorner DarkCorner pos
6 266 160 DarkCorner DarkCorner pos
7 266 158 DarkCorner DarkCorner pos
8 266 156 DarkCorner DarkCorner pos
9 266 154 DarkCorner DarkCorner pos
10 266 152 DarkCorner DarkCorner pos
11 266 150 DarkCorner DarkCorner pos
12 266 148 CUST_13195_PI424014020 CUST_13195_PI424014020 FALSE slr0420 slr0420 unmapped GGGAGCAAAGGGACGACGGAGTTGTTGGAAATAATTTTTAAAGCTATGTTTAGAGCCGTT
13 266 146 CUST_2032_PI423872883 CUST_2032_PI423872883 FALSE slr0833-int2 slr0833 unmapped CCTAGTTCCTCATCACTCATTAATTGTAAAGAGGAGCTTTCTAGTTTACGGGGTAGAGCA
14 266 144 CUST_10111_PI424014020 CUST_10111_PI424014020 FALSE slr1636 slr1636 unmapped ATGGTTAATGGATGCACTGTCGATATGTCGATAGAGGGGAGGGTCAATATTAGGTCAGTT
15 266 142 CUST_15747_PI424014020 CUST_15747_PI424014020 FALSE sll0534 sll0534 unmapped CAACATGGTATTGAGGCGATCCTTGATGTACAGGATTTCCCTGGCCTGAATTTCAATTTC
16 266 140 CUST_7_PI424014020 CUST_7_PI424014020 FALSE slr0612 slr0612 unmapped GATAACGAATGGGAGGATTTCTGGGGGGAAAATCTGGTTCAGTGATAATTTTGGCGATC
17 266 138 CUST_4539_PI424014020 CUST_4539_PI424014020 FALSE ssl3719 ssl3719 unmapped ATGGAATGATGGCGCCTCGTTTTCCTTTGGAAAAATCATATTCCCGTCTCAT
18 266 136 CUST_12913_PI424014020 CUST_12913_PI424014020 FALSE slr0719 slr0719 unmapped GGAAAAGGTCGCCATAGTCACAAAAATCAGCTTTTTTCTCAAGTCTAGGTTAATCGGGGC
19 266 134 CUST_2460_PI423872883 CUST_2460_PI423872883 FALSE sll0446-int1 sll0446 unmapped TACTGATAACTTTCCTGACCCGATCGTCGATTTTCCGCTTGGGCATTGGG
20 266 132 CUST_10671_PI424014020 CUST_10671_PI424014020 FALSE slr0147 slr0147 unmapped TTTTTTTCTGCCCCTAGGGATTCACAGGTGGTCTGTTCACAGTGGAGGTTTTC

Total number of rows: 45220

Table truncated, full table size 6044 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL15867_027432_D_GEO_20100225.txt.gz 1.5 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap