NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15762 Query DataSets for GPL15762
Status Public on Jan 22, 2013
Title Illumina Human v2 MicroRNA Expression BeadChip
Technology type oligonucleotide beads
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Illumina, Inc.
Manufacture protocol See manufacturer's website (www.illumina.com).
 
Description This Platform differs from GPL8179 by including ILMN_3167739 instead of ILMN_3168143.
 
Submission date Jun 30, 2012
Last update date Jan 22, 2013
Contact name Katherine Hill
E-mail(s) khill5@bidmc.harvard.edu
Organization name Beth Israel Deaconess Medical Center
Department Medicine
Lab Dimitrios Spentzos
Street address 330 Brookline Avenue, DA-679
City Boston
State/province MA
ZIP/Postal code 02215
Country USA
 
Samples (117) GSM954459, GSM954460, GSM954461, GSM954462, GSM954463, GSM954464 
Series (3)
GSE39040 microRNA profiling and clinical outcomes in human osteosarcoma (biopsies)
GSE39052 microRNA profiling and clinical outcomes in human osteosarcoma (biopsy/resection pairs)
GSE39058 microRNA- and mRNA-based studies in paraffin-archived human osteosarcoma specimens reveal profiles with reproducible and independent prognostic value

Data table header descriptions
ID
SYMBOL
ILMN_Gene
Search_Key
SEQUENCE probe sequence
TargetMatureSeqs
TargetMatureName
miRNA_ID miRBase identifier
SPOT_ID
NumTargets
TargetMatureVersion
OriginalMatureSeq
OriginalMatureName
Source
Array_Address_Id
Illumicode
Oligo
U3_Seq
Ploidy
Species
Probe_MatchOrder
Chromosome
Probe_Coordinates
Probe_Chr_Orientation

Data table
ID SYMBOL ILMN_Gene Search_Key SEQUENCE TargetMatureSeqs TargetMatureName miRNA_ID SPOT_ID NumTargets TargetMatureVersion OriginalMatureSeq OriginalMatureName Source Array_Address_Id Illumicode Oligo U3_Seq Ploidy Species Probe_MatchOrder Chromosome Probe_Coordinates Probe_Chr_Orientation
ILMN_3167151 ILMN_3167151 hsa-miR-553 hsa-miR-553 AAAACGGTGAGATTTTGTT AAAACGGTGAGATTTTGTTTT hsa-miR-553 hsa-miR-553 1 12 AAAACGGTGAGATTTTGTTTT hsa-miR-553 Sanger miRNAdb (v_8.2, July 2006) 1655 TAGCTGGCCCACGAAATCTGCG ACTTCGTCAGTAACGGACTAGCTGGCCCACGAAATCTGCGAAAACGGTGAGATTTTGTT ACTTCGTCAGTAACGGAC diploid human 1 1 100519399 +
ILMN_3167958 ILMN_3167958 HS_124 HS_124 AAAAGAACATGGGTTGAG AAAAGAACATGGGTTGAG HS_124 HS_124 1 0 AAAAGAACATGGGTTGAG HS_124 Nature Genet 2006 Dec;38:1375-1377 2324 TGAGGTGACGCATCCCTCCATT ACTTCGTCAGTAACGGACTGAGGTGACGCATCCCTCCATTAAAAGAACATGGGTTGAG ACTTCGTCAGTAACGGAC diploid human 1 0 0 +
ILMN_3167403 ILMN_3167403 hsa-miR-320d,hsa-miR-320b,hsa-miR-320a,hsa-miR-320c hsa-miR-320d,hsa-miR-320b,hsa-miR-320a,hsa-miR-320c AAAAGCTGGGTTGAGAGG AAAAGCTGGGTTGAGAGGA,AAAAGCTGGGTTGAGAGGGCAA,AAAAGCTGGGTTGAGAGGGCGA,AAAAGCTGGGTTGAGAGGGT hsa-miR-320d,hsa-miR-320b,hsa-miR-320a,hsa-miR-320c hsa-miR-320d, hsa-miR-320b, hsa-miR-320a, hsa-miR-320c 4 12 AAAAGCTGGGTTGAGAGGGCGAA hsa-miR-320 Sanger miRNAdb (v_8.2, July 2006) 913 ACCCGATGGATAGGTCGGTGAA ACTTCGTCAGTAACGGACACCCGATGGATAGGTCGGTGAAAAAAGCTGGGTTGAGAGG ACTTCGTCAGTAACGGAC diploid human 2,2,1,2 13,X,1,1,8,18,18 40,199,983,139,836,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000 -,-,+,-,-,+,+
ILMN_3167819 ILMN_3167819 hsa-miR-522 hsa-miR-522 AAAATGGTTCCCTTTAGAGT AAAATGGTTCCCTTTAGAGTGT hsa-miR-522 hsa-miR-522 1 12 AAAATGGTTCCCTTTAGAGTGTT hsa-miR-522 Sanger miRNAdb (v_8.2, July 2006) 1375 CAGTAATCAGGCGTCTGTTGGC ACTTCGTCAGTAACGGACCAGTAATCAGGCGTCTGTTGGCAAAATGGTTCCCTTTAGAGT ACTTCGTCAGTAACGGAC diploid human 1 19 58946329 +
ILMN_3167659 ILMN_3167659 hsa-miR-1537 hsa-miR-1537 AAACCGTCTAGTTACAGTTGT AAAACCGTCTAGTTACAGTTGT hsa-miR-1537 hsa-miR-1537 1 12 AAACCGTCTAGTTACAGTTGT HS_92.1 Genome Res 2006 Oct;16:1289-1298 2247 CAGTCAGCAGCCGATCTCGGAT ACTTCGTCAGTAACGGACCAGTCAGCAGCCGATCTCGGATAAACCGTCTAGTTACAGTTGT ACTTCGTCAGTAACGGAC diploid human 1 1 234082945 -
ILMN_3167315 ILMN_3167315 hsa-miR-649 hsa-miR-649 AAACCTGTGTTGTTCAAGAG AAACCTGTGTTGTTCAAGAGTC hsa-miR-649 hsa-miR-649 1 12 AAACCTGTGTTGTTCAAGAGTC hsa-miR-649 Sanger miRNAdb (v_8.2, July 2006) 1954 GCATCCGTCCACAAGTTAGGTG ACTTCGTCAGTAACGGACGCATCCGTCCACAAGTTAGGTGAAACCTGTGTTGTTCAAGAG ACTTCGTCAGTAACGGAC diploid human 1 22 19718502 -
ILMN_3168372 ILMN_3168372 hsa-miR-606 hsa-miR-606 AAACTACTGAAAATCAAAGAT AAACTACTGAAAATCAAAGAT hsa-miR-606 hsa-miR-606 1 12 AAACTACTGAAAATCAAAGAT hsa-miR-606 Sanger miRNAdb (v_8.2, July 2006) 1824 TCACTCAAGGCCGTTAGCTGTG ACTTCGTCAGTAACGGACTCACTCAAGGCCGTTAGCTGTGAAACTACTGAAAATCAAAGAT ACTTCGTCAGTAACGGAC diploid human 1 10 76982281 +
ILMN_3167768 ILMN_3167768 hsa-miR-618 hsa-miR-618 AAACTCTACTTGTCCTTCTGAG AAACTCTACTTGTCCTTCTGAGT hsa-miR-618 hsa-miR-618 1 12 AAACTCTACTTGTCCTTCTGAGT hsa-miR-618 Sanger miRNAdb (v_8.2, July 2006) 1861 TCGATACCGCAAGGTCATTGGC ACTTCGTCAGTAACGGACTCGATACCGCAAGGTCATTGGCAAACTCTACTTGTCCTTCTGAG ACTTCGTCAGTAACGGAC diploid human 1 12 79853729 -
ILMN_3167028 ILMN_3167028 hsa-miR-641 hsa-miR-641 AAAGACATAGGATAGAGTCACCT AAAGACATAGGATAGAGTCACCTC hsa-miR-641 hsa-miR-641 1 12 AAAGACATAGGATAGAGTCACCTC hsa-miR-641 Sanger miRNAdb (v_8.2, July 2006) 1938 CAGTGCCGTTAGACCTACCGAA ACTTCGTCAGTAACGGACCAGTGCCGTTAGACCTACCGAAAAAGACATAGGATAGAGTCACCT ACTTCGTCAGTAACGGAC diploid human 1 19 45480374 -
ILMN_3168208 ILMN_3168208 hsa-miR-330-3p hsa-miR-330-3p AAAGCACACGGCCTGCAG GCAAAGCACACGGCCTGCAGAGA hsa-miR-330-3p hsa-miR-330-3p 1 12 GCAAAGCACACGGCCTGCAGAGA hsa-miR-330 Sanger miRNAdb (v_8.2, July 2006) 935 ATCGGCTAGGCGGATAATGCTG ACTTCGTCAGTAACGGACATCGGCTAGGCGGATAATGCTGAAAGCACACGGCCTGCAG ACTTCGTCAGTAACGGAC diploid human 1 19 50834130 -
ILMN_3166980 ILMN_3166980 HS_121 HS_121 AAAGGGTGTCAGAAAACG AAAGGGTGTCAGAAAACG HS_121 HS_121 1 0 AAAGGGTGTCAGAAAACG HS_121 Nature Genet 2006 Dec;38:1375-1377 2321 AGTCTTCCGCAGCTCCTACAAG ACTTCGTCAGTAACGGACAGTCTTCCGCAGCTCCTACAAGAAAGGGTGTCAGAAAACG ACTTCGTCAGTAACGGAC diploid human 1 0 0 +
ILMN_3168528 ILMN_3168528 hsa-miR-562 hsa-miR-562 AAAGTAGCTGTACCATTTGC AAAGTAGCTGTACCATTTGC hsa-miR-562 hsa-miR-562 1 12 AAAGTAGCTGTACCATTTGC hsa-miR-562 Sanger miRNAdb (v_8.2, July 2006) 1682 TCTCCGGCTGATGGAACCGTAG ACTTCGTCAGTAACGGACTCTCCGGCTGATGGAACCGTAGAAAGTAGCTGTACCATTTGC ACTTCGTCAGTAACGGAC diploid human 1 2 232745666 +
ILMN_3167769 ILMN_3167769 hsa-miR-93 hsa-miR-93 AAAGTGCTGTTCGTGCAG CAAAGTGCTGTTCGTGCAGGTAG hsa-miR-93 hsa-miR-93 1 12 AAAGTGCTGTTCGTGCAGGTAG hsa-miR-93 Sanger miRNAdb (v_8.2, July 2006) 1563 AAGCCGAGTATTGGGGTAGTCC ACTTCGTCAGTAACGGACAAGCCGAGTATTGGGGTAGTCCAAAGTGCTGTTCGTGCAG ACTTCGTCAGTAACGGAC diploid human 1 7 99529397 -
ILMN_3167510 ILMN_3167510 hsa-miR-20a hsa-miR-20a AAAGTGCTTATAGTGCAGGT TAAAGTGCTTATAGTGCAGGTAG hsa-miR-20a hsa-miR-20a 1 12 TAAAGTGCTTATAGTGCAGGTAG hsa-miR-20a Sanger miRNAdb (v_8.2, July 2006) 718 ATCGGAGACCAACCGTAGTCGT ACTTCGTCAGTAACGGACATCGGAGACCAACCGTAGTCGTAAAGTGCTTATAGTGCAGGT ACTTCGTCAGTAACGGAC diploid human 1 13 90801326 +
ILMN_3168147 ILMN_3168147 hsa-miR-520h,hsa-miR-520g hsa-miR-520h,hsa-miR-520g AAAGTGCTTCCCTTTAGAGT ACAAAGTGCTTCCCTTTAGAGT,ACAAAGTGCTTCCCTTTAGAGTGT hsa-miR-520h,hsa-miR-520g hsa-miR-520h, hsa-miR-520g 2 12 ACAAAGTGCTTCCCTTTAGAGT hsa-miR-520h Sanger miRNAdb (v_8.2, July 2006) 1360 AAGGGCCAGTCGCCTTTGTAAC ACTTCGTCAGTAACGGACAAGGGCCAGTCGCCTTTGTAACAAAGTGCTTCCCTTTAGAGT ACTTCGTCAGTAACGGAC diploid human 1,1 19,19 5,893,763,158,917,280 +,+
ILMN_3166935 ILMN_3166935 hsa-miR-329 hsa-miR-329 AACACACCTGGTTAACCTC AACACACCTGGTTAACCTCTTT hsa-miR-329 hsa-miR-329 1 12 AACACACCTGGTTAACCTCTTT hsa-miR-329 Sanger miRNAdb (v_8.2, July 2006) 931 CGGCAGATAGCACGTTTCGACT ACTTCGTCAGTAACGGACCGGCAGATAGCACGTTTCGACTAACACACCTGGTTAACCTC ACTTCGTCAGTAACGGAC diploid human 2 14,14 100,562,923,100,563,000 +,+
ILMN_3167849 ILMN_3167849 hsa-miR-552 hsa-miR-552 AACAGGTGACTGGTTAGACA AACAGGTGACTGGTTAGACAA hsa-miR-552 hsa-miR-552 1 12 AACAGGTGACTGGTTAGACAA hsa-miR-552 Sanger miRNAdb (v_8.2, July 2006) 1653 ACCTATTTGGCGGAGGACCACT ACTTCGTCAGTAACGGACACCTATTTGGCGGAGGACCACTAACAGGTGACTGGTTAGACA ACTTCGTCAGTAACGGAC diploid human 1 1 34907823 -
ILMN_3167761 ILMN_3167761 hsa-miR-212 hsa-miR-212 AACAGTCTCCAGTCACGG TAACAGTCTCCAGTCACGGCC hsa-miR-212 hsa-miR-212 1 12 TAACAGTCTCCAGTCACGGCC hsa-miR-212 Sanger miRNAdb (v_8.2, July 2006) 732 ACCCACAGACGTTGGTCCGTAG ACTTCGTCAGTAACGGACACCCACAGACGTTGGTCCGTAGAACAGTCTCCAGTCACGG ACTTCGTCAGTAACGGAC diploid human 1 17 1900355 -
ILMN_3168446 ILMN_3168446 hsa-miR-494 hsa-miR-494 AACATACACGGGAAACCT TGAAACATACACGGGAAACCTC hsa-miR-494 hsa-miR-494 1 12 TGAAACATACACGGGAAACCTCTT hsa-miR-494 Sanger miRNAdb (v_8.2, July 2006) 1151 GACCTGTACTCTCGCGCAATTC ACTTCGTCAGTAACGGACGACCTGTACTCTCGCGCAATTCAACATACACGGGAAACCT ACTTCGTCAGTAACGGAC diploid human 1 14 100565770 +
ILMN_3168036 ILMN_3168036 HS_90 HS_90 AACATCTGCAGCAAGGT AACATCTGCAGCAAGGTCAA HS_90 HS_90 1 0 AACATCTGCAGCAAGGTCAA HS_90 Nature Genet 2006 Dec;38:1375-1377 5050 TAACTACCTTGACCGGAACACCTG ACTTCGTCAGTAACGGACTAACTACCTTGACCGGAACACCTGAACATCTGCAGCAAGGT ACTTCGTCAGTAACGGAC diploid human 1 0 0 +

Total number of rows: 1146

Table truncated, full table size 342 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap