NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15098 Query DataSets for GPL15098
Status Public on Jan 07, 2012
Title RPCI Human HB21K
Technology type spotted DNA/cDNA
Distribution non-commercial
Organism Homo sapiens
Manufacturer RPCI Genomics Shared Resource
Manufacture protocol Isolation of BAC plasmid DNA: BAC clone plasmid DNAs, used as templates for PCR representations are prepared using a Qiagen BioRobot 3000. Each clone is retrieved from archival copies of the RPCI-11 BAC Resource, maintained at RPCI. The clones are streaked to single colony, grown overnight (16-18 hours) as 1.0ml pre-cultures in 96 deep-well plates at 37 C in a New Brunswick environmental shaker, and then re-inoculated as 2ml prep-cultures in 48 deep-well plates. After incubation, the cultures are RNase treated and prepped in the BioRobot 3000 using R.E.A.L. Prep 96 BioRobot kits (Qiagen). The BAC DNAs are resuspended in TE and serve as templates for restriction digestion and PCR amplification. We have found that Qiagen prepared DNA is of high quality and outperforms phenol:chloroform extraction methods for the highly sensitive restriction digestion and ligation steps.
Ligation of adapters: The adapters are ligated to the digested DNA by first annealing Mse-21 and Mse-12 primers. 1 ul of each digest (1 ng/ul), is added to 0.5 ul of 100 uM Mse-12 (TAACTAGCATGC), 0.5 ul of 100 uM Mse-21 (5’ aminolinker AGTGGGATTCCGCATGCTAGT) in a final volume of 7.5 ul using a thermalcycler (MJ Research). The mixture is incubated at 65 C for 1 min followed by ramping the temperature down to 15 C with a ramp-speed of 1.3 C per minute. When the temperature reaches 15 C, ligation proceeds with 1 ul of 10 mM ATP, 0.5 ul One-Phor-All-Buffer-Plus (10x) and 1 ul T4-DNA ligase (5 U/ul, Invitrogen) added to each tube and incubated at 15 C overnight.
PCR amplification: Two rounds of amplification are required to produce enough product for array generation as described in Cowell, J. K. and N. J. Nowak. 2003. High-resolution analysis of genetic events in cancer cells using bacterial artificial chromosome arrays and comparative genome hybridization. Adv Cancer Res 90:91-125. A single BAC PCR-representation produces enough printing solution for over 4,000 arrays. Preparation of DNA spotting solutions: PCR products (100 ul) are purified for printing by a series of ethanol precipitation steps, followed by resuspension of the pellets in 20 ul of 25% DMSO in H2O (final DNA concentration ~0.8 ug/ul) using a Qfill2 (Genetix). The DNA solutions are rearrayed into Genetix 384-well V-bottom plates using a Hydra 96-PP liquid handling system, and stored at 4 C until printing. We determined that DNA prepared using LM-PCR performed superiorly over other methods, including degenerate oligonucleotide primer PCR, inter Alu PCR and amplification of BAC subclones mixtures. 25% DMSO has several properties that make it an ideal solution for resuspending the amplicons. First, it acts as a denaturant, rendering the printing solution single-stranded for optimal slide binding and subsequent hybridization. Secondly, DMSO does not evaporate, so the printing solution volume is not affected by exposure to the environment during multiple print runs.
Array printing: Slides are printed using a MicroGrid ll TAS arrayer (Genomic Solutions) using 10K Microspot pins at 48% relative humidity, 22?C. We have a climate controlled, HEPA filtered room to minimize environmental changes that can affect printing. In addition, the arrayer is supplied with HEPA filtered air to further maintain a dust-free environment. We print each BAC clone in triplicate to create an array of on amino-silanated glass slides (Schott Nexterion, Type A+). The printed slides dry overnight, and are UV-crosslinked (350 mJ) in a Stratalinker 2400 (Stratagene). The slides are visually inspected and stored in a dessicated environment and are hybridized without additional treatment. Attempts at post-print processing or inclusion of pre-hybridization steps resulted in background issues that made the images difficult to analyze. We found no indication of DNA loss from the spots at any stage of the procedure when we performed hybridization in formamide buffers at 37°C (via DAPI staining).
Support glass
Coating aminosilane
 
 
Submission date Jan 06, 2012
Last update date Jan 07, 2012
Contact name Amanda Perez
E-mail amanda.perez@roswellpark.org
Organization name Roswell Park Cancer Institute
Street address Elm and Carlton Streets
City Buffalo
State/province NY
ZIP/Postal code 14263
Country USA
 
Samples (4) GSM864242, GSM864243, GSM864244, GSM864245
Series (1)
GSE35190 aCGH study of iPS cells from two normal subjects and two Parkinson's disease patients with parkin mutations

Data table header descriptions
ID
Chromosome
start Start location of BAC clone in base pairs
Stop Stop location of BAC clone in base pairs
Center Center location of BAC clone in base pairs
g_loc
Band
Mapped by Method that the BAC clone was mapped to the genome
CLONE_ID

Data table
ID Chromosome start Stop Center g_loc Band Mapped by CLONE_ID
RP11-430E19 chr1 17844 167209 92526.5 92526.5 p36.33 BEP RP11-430E19
RP11-206L10 chr1 622813 802341 712577 712577 p36.33 BEP RP11-206L10
RP11-671C15 chr1 799490 799881 799685.5 799685.5 p36.33 FISH RP11-671C15
RP11-76K6 chr1 1071325 1247478 1159401.5 1159401.5 p36.33 BEP RP11-76K6
RP11-846C3 chr1 1457625 1687885 1572755 1572755 p36.33 BEP RP11-846C3
RP11-1113I16 chr1 1569146 1780537 1674841.5 1674841.5 p36.33 BEP RP11-1113I16
RP11-201E15 chr1 1783391 1783787 1783589 1783589 p36.33 FISH RP11-201E15
RP11-156L15 chr1 1873300 2049744 1961522 1961522 p36.33 BEP RP11-156L15
RP11-82D16 chr1 2036610 2198172 2117391 2117391 p36.33 FISH RP11-82D16
RP11-47P3 chr1 2036556 2216655 2126605.5 2126605.5 p36.33 BEP RP11-47P3
RP11-181G12 chr1 2062346 2242269 2152307.5 2152307.5 p36.33 FISH RP11-181G12
RP11-799N13 chr1 2146573 2339453 2243013 2243013 p36.33 BEP RP11-799N13
RP11-1012C20 chr1 2291749 2492018 2391883.5 2391883.5 p36.32 BEP RP11-1012C20
RP11-70N12 chr1 2730562 2912411 2821486.5 2821486.5 p36.32 BEP RP11-70N12
RP11-737N8 chr1 2832514 3003977 2918245.5 2918245.5 p36.32 BEP RP11-737N8
RP11-659J6 chr1 3049206 3211162 3130184 3130184 p36.32 BEP RP11-659J6
RP11-78E10 chr1 3153496 3323588 3238542 3238542 p36.32 BEP RP11-78E10
RP11-893K17 chr1 3323690 3548139 3435914.5 3435914.5 p36.32 BEP RP11-893K17
RP11-62M23 chr1 3706050 3706612 3706331 3706331 p36.32 FISH RP11-62M23
RP11-718D19 chr1 3916941 4110662 4013801.5 4013801.5 p36.32 BEP RP11-718D19

Total number of rows: 17958

Table truncated, full table size 1374 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap