GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Platform GPL15033 Query DataSets for GPL15033
Status Public on Dec 20, 2011
Title Arborea spruce 32K
Technology type spotted oligonucleotide
Distribution non-commercial
Organisms Picea glauca; Picea sitchensis
Manufacturer Vancouver Prostate Centre Microarray Facility
Manufacture protocol The sequences included in the microarray were selected on the basis of reproducible sequence quality form all of the ESTs and FL-cDNA described for P. glauca in Rigault et al. (2011) and P. sitchensis in Ralph et al. (2008) (Table 1A). To obtain a robust probe set, we selected sequences that were either detected in the two species, verified with two technologies (Sanger and 454) or were derived from a FL-cDNA (Table 1A). The probes were 70 nucleotides in length, and were designed to minimize similarity with other sequences in the dataset. Sequence similarity between the probes and known sequences in P. sitchensis and P. glauca was determined from sequence alignments. The microrray contains 25,045 probes that match with known P. glauca sequences; however, they represent 23,853 unique cDNA gene based on the most recent clustering (Rigault et al., 2011), such that 1007 genes are represented by more than one probe. The microarray consists of 33,984 spotted features including 33,024 sample spots (Invitrogen, Carlsbad, California), 240 negative buffer spots, and 480 Spot Report Alien Oligos (Agilent Technologies, Inc., Santa Clara, CA, USA). Oligonucleotides were consolidated into 384-well plates, lyophilized by speed-Vac, and resuspended in 3X SSC to a printing concentration of 30 µM. Oligos were printed on aminosilane slides (Erie, Hudson, NH, USA) with a QArrayMax microarray printer (Genetix Limited, Hampshire, UK) using 946MP2 microarray pins (ArrayIt Corp, Sunnyvale, CA, USA) in a 48-pin tool depositing ~0.5 nL per spot onto the slide. The resulting microarrays had a 4 x 12 subgrid layout with 708 spots per subgrid, each spot having approximate diameter and pitch of 90µm and 160 µm, respectively. A 280-bp GFP (green fluorescent protein) oligonucleotide was printed in subgrid corners to assist in grid alignment during image processing. The slides were crosslinked in a UV Stratalinker 2400 (Agilent Technologies, Inc.) at 300 mJ. Array quality was assessed by visual inspection and hybridization of representative slides from a print run by dye-labelled random 9-mer oligonucleotides. The quality control images were acquired via the GenePix 4200AL scanner (Molecular Devices, CA, USA) at a 10 micron resolution and quantified with the Imagene 8.0 software suite. Printing and quality control was performed by the Vancouver Prostate Centre Microarray Facility, Vancouver, Canada.
Support glass
Coating aminosilane
Web link
Citation(s) 22931377
Submission date Dec 19, 2011
Last update date Jun 18, 2013
Contact name John MacKay
Organization name Université Laval
Department Centre d'étude de la forêt
Lab Dr. John MacKay
Street address 1030, avenue de la Médecine, Pavillon C.-E. Marchand
City Québec
State/province Québec
ZIP/Postal code G1V 0A6
Country Canada
Samples (563) GSM866241, GSM866242, GSM866243, GSM866244, GSM866245, GSM866246 
Series (9)
GSE35337 Direct measurement of heritable gene expression within single individuals from wild populations.
GSE35624 PiceaGenExpress database of transcription profiles
GSE35847 Interspecies Pinaceae comparison experiment

Data table header descriptions
Array_Block Subarray
Array_Row Vertical position in subarray
Array_Column Horizontal position in subarray
Probe_Name Probe name
Probe_Type Type of probe
Cluster_Name (GCAT) Genome Quebec cluster identifiers (
Clone_Name (GCAT) Genome Quebec clone identifiers (
GB_Accession GenBank accession numbers for corresponding expressed sequence tags
GB_ACC GenBank accession number
Species Specie from which the oligonucleotide sequence is derived. WS Picea glauca (White spruce); SS Picea sitchensis (Sitka spruce)
SEQUENCE Probe sequence
PFAM_Accession Pfam family identifier
PFAM_Description Pfam family description

Data table
ID Array_Block Array_Row Array_Column Probe_Name Probe_Type Cluster_Name (GCAT) Clone_Name (GCAT) GB_Accession GB_ACC Species SEQUENCE PFAM_Accession PFAM_Description SPOT_ID
1 1 1 1 GFP Control-GFP --GFP
3 1 1 3 Spruce_24264 Gene GQ0204_C11 GQ02908_H11 BT102964 BT102964 WS TGGCCGAAGTAAATTCATTTTGTCTGCGGGGCACTGTTAATTGCCTGTGGATTGATAATGACGGAACACT PF05564 Dormancy/auxin associated protein
5 1 1 5 Empty Empty --Empty
6 1 1 6 GFP1 Control-GFP --GFP1
7 1 1 7 Empty Empty --Empty
13 1 1 13 Spruce_27002 Gene GQ03310_I22 GQ03310_I22 BT112133 BT112133 WS GATCGGAATGTAGAAATGATCCCAAGGTTATATAGATATAGTACCTTAAAACTTCTTGAATGGAAGAACT PF02798 Glutathione S-transferase, N-terminal domain
14 1 1 14 Spruce_05475 Gene GQ03808_J04 GQ03808_J04 BT116884 BT116884 WS GAGATAACTACAGGTGGAGCAGATTATTGTTTTGAATGTGTTGGTAATGTTGAAATAATGCGGGCCGCCT PF00107 Zinc-binding dehydrogenase
16 1 1 16 Spruce_30468 Gene GQ02821_A08 GQ02821_A08 BT105335 BT105335 WS TAAAGCTGTAAGAGGAAGAGTCCCTGTACTATTTGATGGTGGGATCCGTCGTGGTACAGATGTCTTTAAA PF01070 FMN-dependent dehydrogenase

Total number of rows: 34992

Table truncated, full table size 5354 Kbytes.

Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap