NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15033 Query DataSets for GPL15033
Status Public on Dec 20, 2011
Title Arborea spruce 32K
Technology type spotted oligonucleotide
Distribution non-commercial
Organisms Picea glauca; Picea sitchensis
Manufacturer Vancouver Prostate Centre Microarray Facility
Manufacture protocol The sequences included in the microarray were selected on the basis of reproducible sequence quality form all of the ESTs and FL-cDNA described for P. glauca in Rigault et al. (2011) and P. sitchensis in Ralph et al. (2008) (Table 1A). To obtain a robust probe set, we selected sequences that were either detected in the two species, verified with two technologies (Sanger and 454) or were derived from a FL-cDNA (Table 1A). The probes were 70 nucleotides in length, and were designed to minimize similarity with other sequences in the dataset. Sequence similarity between the probes and known sequences in P. sitchensis and P. glauca was determined from sequence alignments. The microrray contains 25,045 probes that match with known P. glauca sequences; however, they represent 23,853 unique cDNA gene based on the most recent clustering (Rigault et al., 2011), such that 1007 genes are represented by more than one probe. The microarray consists of 33,984 spotted features including 33,024 sample spots (Invitrogen, Carlsbad, California), 240 negative buffer spots, and 480 Spot Report Alien Oligos (Agilent Technologies, Inc., Santa Clara, CA, USA). Oligonucleotides were consolidated into 384-well plates, lyophilized by speed-Vac, and resuspended in 3X SSC to a printing concentration of 30 µM. Oligos were printed on aminosilane slides (Erie, Hudson, NH, USA) with a QArrayMax microarray printer (Genetix Limited, Hampshire, UK) using 946MP2 microarray pins (ArrayIt Corp, Sunnyvale, CA, USA) in a 48-pin tool depositing ~0.5 nL per spot onto the slide. The resulting microarrays had a 4 x 12 subgrid layout with 708 spots per subgrid, each spot having approximate diameter and pitch of 90µm and 160 µm, respectively. A 280-bp GFP (green fluorescent protein) oligonucleotide was printed in subgrid corners to assist in grid alignment during image processing. The slides were crosslinked in a UV Stratalinker 2400 (Agilent Technologies, Inc.) at 300 mJ. Array quality was assessed by visual inspection and hybridization of representative slides from a print run by dye-labelled random 9-mer oligonucleotides. The quality control images were acquired via the GenePix 4200AL scanner (Molecular Devices, CA, USA) at a 10 micron resolution and quantified with the Imagene 8.0 software suite. Printing and quality control was performed by the Vancouver Prostate Centre Microarray Facility, Vancouver, Canada.
Support glass
Coating aminosilane
 
 
Web link http://www.smartforests.ca/en-ca/home.aspx
Citation(s) 22931377
Submission date Dec 19, 2011
Last update date Jun 18, 2013
Contact name John MacKay
E-mail john.mackay@sbf.ulaval.ca
Organization name Université Laval
Department Centre d'étude de la forêt
Lab Dr. John MacKay
Street address 1030, avenue de la Médecine, Pavillon C.-E. Marchand
City Québec
State/province Québec
ZIP/Postal code G1V 0A6
Country Canada
 
Samples (563) GSM866241, GSM866242, GSM866243, GSM866244, GSM866245, GSM866246 
Series (9)
GSE35337 Direct measurement of heritable gene expression within single individuals from wild populations.
GSE35624 PiceaGenExpress database of transcription profiles
GSE35847 Interspecies Pinaceae comparison experiment

Data table header descriptions
ID
Array_Block Subarray
Array_Row Vertical position in subarray
Array_Column Horizontal position in subarray
Probe_Name Probe name
Probe_Type Type of probe
Cluster_Name (GCAT) Genome Quebec cluster identifiers (https://www.gydle.com/arborea/gcat/)
Clone_Name (GCAT) Genome Quebec clone identifiers (https://www.gydle.com/arborea/gcat/)
GB_Accession GenBank accession numbers for corresponding expressed sequence tags
GB_ACC GenBank accession number
Species Specie from which the oligonucleotide sequence is derived. WS Picea glauca (White spruce); SS Picea sitchensis (Sitka spruce)
SEQUENCE Probe sequence
PFAM_Accession Pfam family identifier
PFAM_Description Pfam family description
SPOT_ID

Data table
ID Array_Block Array_Row Array_Column Probe_Name Probe_Type Cluster_Name (GCAT) Clone_Name (GCAT) GB_Accession GB_ACC Species SEQUENCE PFAM_Accession PFAM_Description SPOT_ID
1 1 1 1 GFP Control-GFP --GFP
2 1 1 2 Spruce_14029 Gene GQ04008_F18 GQ04008_F18 BT118632 BT118632 WS GTGAATGATGGTGCAAATCTATACTACTACACAACAACATTTGAAGGTTCAGTACCAGGGGCAGAAGCTG NULL NULL
3 1 1 3 Spruce_24264 Gene GQ0204_C11 GQ02908_H11 BT102964 BT102964 WS TGGCCGAAGTAAATTCATTTTGTCTGCGGGGCACTGTTAATTGCCTGTGGATTGATAATGACGGAACACT PF05564 Dormancy/auxin associated protein
4 1 1 4 Spruce_02844 Gene GQ03412_G21 GQ03412_G21 BT113528 BT113528 WS CGTCCAAGGGATCCCCGAGAAGGCAATAAAAAGCCTCTTGATAAGAAACTAAAGGGACCCTAAGAAAAAT NULL NULL
5 1 1 5 Empty Empty --Empty
6 1 1 6 GFP1 Control-GFP --GFP1
7 1 1 7 Empty Empty --Empty
8 1 1 8 Spruce_21632 Gene GQ02806_F18 GQ02806_F18 BT104093 BT104093 WS GTTTAGCAGGAGCTGGAATAGTGGGCATACTAAAGAAATTGGGGAGAGATGTCATTGGAGACACAGGTAA NULL NULL
9 1 1 9 Spruce_17308 Gene GQ03238_K24 GQ03238_K24 BT111506 BT111506 WS ACTTTTCCAACATCAAACAGCCAAACACAGCGCCATTATCTCTCATCTCTGTGGAAGACAAGTGACCCAG NULL NULL
10 1 1 10 Spruce_08578 Gene NA WS0373_J17 WS0373_J17 SS ACTATGGGCACAAGTCAGGGATTTTGGTCGTGTATCTTAATTGTGTTATCTTACCCAGAGTGATTTGGGG NULL NULL
11 1 1 11 Spruce_28400 Gene GQ04103_E19 GQ04103_E19 BT119266 BT119266 WS GATGCAGGAGCATAGGCTCACGAAAACAAAGTCACCCATGACTTCATCAAAGTTGAGAGAATTTAAAGAG NULL NULL
12 1 1 12 Spruce_26062 Gene GQ04109_F19 WS00110_P14 BT119730 BT119730 WS GAGGGCACTGAGTTATCCAGGTAGCCACTGAATAAAAAGTCTGAGAAATATAGATTAACACCCTAAAAAC NULL NULL
13 1 1 13 Spruce_27002 Gene GQ03310_I22 GQ03310_I22 BT112133 BT112133 WS GATCGGAATGTAGAAATGATCCCAAGGTTATATAGATATAGTACCTTAAAACTTCTTGAATGGAAGAACT PF02798 Glutathione S-transferase, N-terminal domain
14 1 1 14 Spruce_05475 Gene GQ03808_J04 GQ03808_J04 BT116884 BT116884 WS GAGATAACTACAGGTGGAGCAGATTATTGTTTTGAATGTGTTGGTAATGTTGAAATAATGCGGGCCGCCT PF00107 Zinc-binding dehydrogenase
15 1 1 15 Spruce_24651 Gene GQ02821_L08 GQ02821_L08 BT105384 BT105384 WS TAGGAGCGTTGTTGCACCGAAGGTGTTCTTTTAAGGGGAAGGTCGTGTATAAGCCTTTTGTTGTCCATCC PF00125 Core histone H2A/H2B/H3/H4
16 1 1 16 Spruce_30468 Gene GQ02821_A08 GQ02821_A08 BT105335 BT105335 WS TAAAGCTGTAAGAGGAAGAGTCCCTGTACTATTTGATGGTGGGATCCGTCGTGGTACAGATGTCTTTAAA PF01070 FMN-dependent dehydrogenase
17 1 1 17 Spruce_28306 Gene GQ03708_F08 GQ03708_F08 BT115898 BT115898 WS AATGAACTTGGTGCTGGGAATGCTGAGGCTGCCTGCTTTTCAGTTTTTGTTTCAGTGGCTACATCTTCAA PF01554 MatE
18 1 1 18 Spruce_22759 Gene WS02629_A19 WS02629_A19 WS02629_A19 WS TTCAAATAATTTACTCTCCTCTTCTGGACAGCAAACTGGCACCCCATGTTCTGTGCTGGCTTCTGAAAGT NULL NULL
19 1 1 19 Spruce_19376 Gene GQ03813_E21 GQ03813_E21 BT117125 BT117125 WS TACAGAGAATAATGATGTAGCTCCAAAGGTGAAGAGGCGAAAACGTGAAAGCGGTCACTCACAGGCAGAT NULL NULL
20 1 1 20 Spruce_08472 Gene GQ01813_G07 GQ01813_G07 BT102329 BT102329 WS TAGAAGAAAGTCGACAATCGGAACAGTTAGAAGAAAATCGACAATCGGAAGATGGCGTTACCTTAGACCC NULL NULL

Total number of rows: 34992

Table truncated, full table size 5354 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap