GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Platform GPL14550 Query DataSets for GPL14550
Status Public on Sep 08, 2011
Title Agilent-028004 SurePrint G3 Human GE 8x60K Microarray (Probe Name Version)
Technology type in situ oligonucleotide
Distribution commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at
Description SurePrint G3 Human GE 8x60K Microarray

*** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL13607.
Submission date Sep 08, 2011
Last update date Oct 11, 2016
Organization Agilent Technologies
Phone 877-424-4536
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
Samples (7557) GSM689155, GSM689156, GSM689157, GSM689158, GSM689159, GSM689160 
Series (357)
GSE24844 LSD1/KDM1 regulates the balance between self-renewal and differentiation in human embryonic stem cells.
GSE32006 Human mesenchymal stem cells at 24 hours and 0.5% O2, gene expression and exon array, three independent biological replicates
GSE32189 Profile of gene expression in K562 cells exposed to 2 mM sodium valproate for 12 hours using Agilent SurePrint G3 Human GE 8x60K Microarray.
Alternative to GPL13607

Data table header descriptions
ID Agilent feature number
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeq Accession number
GB_ACC GenBank Accession number
GENE Entrez Gene ID

Data table
(+)E1A_r60_1 (+)E1A_r60_1 pos
(+)E1A_r60_3 (+)E1A_r60_3 pos
(+)E1A_r60_a104 (+)E1A_r60_a104 pos
(+)E1A_r60_a107 (+)E1A_r60_a107 pos
(+)E1A_r60_a135 (+)E1A_r60_a135 pos
(+)E1A_r60_a20 (+)E1A_r60_a20 pos
(+)E1A_r60_a22 (+)E1A_r60_a22 pos
(+)E1A_r60_a97 (+)E1A_r60_a97 pos
(+)E1A_r60_n11 (+)E1A_r60_n11 pos
(+)E1A_r60_n9 (+)E1A_r60_n9 pos
3xSLv1 3xSLv1 neg
A_19_P00315452 A_19_P00315452 FALSE lincRNA:chr18:59273300-59274144_R chr18:59273360-59273301 hs|18q21.33 lincRNA:chr18:59273300-59274144 reverse strand GACTGACGACAAGAAGGCTCTTCGTCCCTGTTTTTGAAATAAACATGGGTATAATCTGAA
A_19_P00315459 A_19_P00315459 FALSE lincRNA:chrX:149128983-149131423_F chrX:149131107-149131166 hs|Xq28 lincRNA:chrX:149128983-149131423 forward strand AGCCCCCACTGTTCCACTTATTGTGATGGTTTGTATATCTTTATTTCAAAGAAGATCTGT
A_19_P00315469 A_19_P00315469 FALSE lincRNA:chr3:106959773-107004511_R chr3:106959833-106959774 hs|3q13.11 lincRNA:chr3:106959773-107004511 reverse strand GCAAATCGGAATCCACGGAAGAAAATTCACCTCTTAAGGATCCAGTCCGGAAAGGGATGG
A_19_P00315473 A_19_P00315473 FALSE lincRNA:chr3:156817296-156818920_R chr3:156817360-156817301 hs|3q25.31 lincRNA:chr3:156817296-156818920 reverse strand ACTGAACAGAACAGGCAGGAGGTATTTTCTTCTGAAGAGCTGTCAAGAGCCAATACAGCA
A_19_P00315482 A_19_P00315482 FALSE lincRNA:chr6:22136433-22147296_R chr6:22136556-22136497 hs|6p22.3 lincRNA:chr6:22136433-22147296 reverse strand GAATCGGAGGTGCCTGGGTCATCTCACAGAGCCAAACAAATACAATTAGCTATTGCAAAG
A_19_P00315490 A_19_P00315490 FALSE lincRNA:chr15:67276445-67351512_F chr15:67278776-67278835 hs|15q23 lincRNA:chr15:67276445-67351512 forward strand TCAGCATCCCGAGAGAATGCAAGATGTTGTGACCAAGGTGTCTAAATATCAAACGCAAGT
A_19_P00315492 A_19_P00315492 FALSE lincRNA:chr4:129376323-129391820_F chr4:129376376-129376435 hs|4q28.2 lincRNA:chr4:129376323-129391820 forward strand AGGCAGCCTTGCTGTTGGGGGTTATTGGCAGCTGTTGGGGGTTAGAGACAGGACTCTCAT
A_19_P00315493 A_19_P00315493 FALSE lincRNA:chr14:71954577-71956430_F chr14:71956255-71956314 hs|14q24.2 lincRNA:chr14:71954577-71956430 forward strand ATATATTCTTCAGTGTGATTTAGGTGAGTCAGGAATTTTTCCTCTGGAGACTGCCTAAAT
A_19_P00315496 A_19_P00315496 FALSE lincRNA:chr3:162937703-162996391_F chr3:162993048-162993107 hs|3q26.1 lincRNA:chr3:162937703-162996391 forward strand TATTTATCATTGCTGTCATTCATTTCAAAGACGGGAATGTCAGAATGTCTTGTGCGGGGT

Total number of rows: 42545

Table truncated, full table size 23702 Kbytes.

Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap