NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL13912 Query DataSets for GPL13912
Status Public on Jul 13, 2011
Title Agilent-028005 SurePrint G3 Mouse GE 8x60K Microarray (Feature Number version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Mus musculus
Manufacturer Agilent Technologies
Manufacture protocol See manufacturer's web site (http://www.agilent.com/).
 
Description Design ID: 028005
Build version: mm9:NCBI37:Jul2007

Arrays of this design have barcodes that begin with 16028005 or 2528005.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

*** A different version of this platform with the Agilent Probe names in the ID column is assigned accession number GPL10787.
 
Submission date Jul 13, 2011
Last update date Jul 19, 2017
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (4327) GSM759882, GSM759929, GSM759930, GSM759931, GSM759932, GSM759933 
Series (373)
GSE30642 Mouse Macrophage Cells: Control vs. Burkholderia pseudomallei infected cells
GSE30647 Role of miR-125b in B-cell acute lymphoblastic leukemia (B-ALL)
GSE31731 Gene expression profile of HCCs developed in miR-122 knockout mice compared to age-matched wild type mice
Relations
Alternative to GPL10787

Data table header descriptions
ID Agilent Feature Number
COL Column
ROW Row
NAME Name
SPOT_ID Spot identifier
CONTROL_TYPE Control type
GB_ACC GenBank or RefSeq accession
GENE_ID NCBI Gene ID
GENE_SYMBOL Gene symbol
GENE_NAME Gene name
UNIGENE_ID UniGene ID
ENSEMBL_ID Ensembl ID
ACCESSION_STRING Accession string
CHROMOSOMAL_LOCATION Chromosomal location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Oligo sequence

Data table
ID COL ROW NAME SPOT_ID CONTROL_TYPE GB_ACC GENE_ID GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
1 192 328 GE_BrightCorner pos
2 192 326 DarkCorner pos
3 192 324 DarkCorner pos
4 192 322 A_55_P2051983 FALSE NM_001001803 408198 Spink7 serine peptidase inhibitor, Kazal type 7 (putative) Mm.478742 ENSMUST00000076194 ref|NM_001001803|ens|ENSMUST00000076194|gb|BC148575|gb|BC156750 chr18:62753954-62753895 mm|18qE1 Mus musculus serine peptidase inhibitor, Kazal type 7 (putative) (Spink7), mRNA [NM_001001803] GO:0003674(molecular_function)|GO:0004867(serine-type endopeptidase inhibitor activity)|GO:0005575(cellular_component)|GO:0005576(extracellular region)|GO:0008150(biological_process)|GO:0030414(peptidase inhibitor activity) CAGTTTGTGGATCTGACTATATCACTTACGGGAATAAATGCAAGCTGTGTACAGAGATCT
5 192 320 A_52_P169082 FALSE NM_021294 13168 Dbil5 diazepam binding inhibitor-like 5 Mm.347413 ref|NM_021294 chr11:76031955-76032014 mm|11qB5 Mus musculus diazepam binding inhibitor-like 5 (Dbil5), mRNA [NM_021294] GO:0000062(fatty-acyl-CoA binding)|GO:0005488(binding)|GO:0005737(cytoplasm)|GO:0006810(transport)|GO:0008289(lipid binding) TAAACAAAGGGATGTCCAAGATGGATGCCATGAGGATCTACATTGCTAAAGTGGAAGAGC
6 192 318 A_30_P01028193 FALSE chr14:47978277-47985238_F chr14:47982421-47982480 mm|14qC1 lincRNA:chr14:47978277-47985238 forward strand CCATTAGAGCTGACTCCAAGCCATCAGTCCCAACGAGGAATGGTGAATTGGCTTCATCTA
7 192 316 A_52_P237997 FALSE NM_177274 320840 Negr1 neuronal growth regulator 1 Mm.317293 ref|NM_177274 chr3:156834624-156834683 mm|3qH4 Mus musculus neuronal growth regulator 1 (Negr1), transcript variant 2, mRNA [NM_177274] GO:0003674(molecular_function)|GO:0005886(plasma membrane)|GO:0007155(cell adhesion)|GO:0008150(biological_process)|GO:0016020(membrane)|GO:0030425(dendrite)|GO:0031225(anchored to membrane)|GO:0043025(neuronal cell body) GTGGAGCTTCCATATCCAAAATCGTGCAACTGGGATTTTTCTACAGACACACAAGTTAGC
8 192 314 A_51_P414243 FALSE NM_153540 215494 C85492 expressed sequence C85492 Mm.402151 ENSMUST00000084743 ref|NM_153540|ens|ENSMUST00000084743|gb|AK042747|gb|AK133802 chr9:121890800-121890741 mm|9qF4 Mus musculus expressed sequence C85492 (C85492), mRNA [NM_153540] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0005576(extracellular region)|GO:0008150(biological_process)|GO:0016740(transferase activity)|GO:0016757(transferase activity, transferring glycosyl groups) TAATCTTTGAATTTCATCTGTAGCTGAGTGACAGGTGTGTTTGGAGCAGTCATTAAATGA
9 192 312 A_55_P2136348 FALSE NM_007720 12776 Ccr8 chemokine (C-C motif) receptor 8 Mm.442098 ENSMUST00000048777 ref|NM_007720|ens|ENSMUST00000048777|gb|BC101966|gb|BC101967 chr9:120003293-120003352 mm|9qF4 Mus musculus chemokine (C-C motif) receptor 8 (Ccr8), mRNA [NM_007720] GO:0004871(signal transducer activity)|GO:0004872(receptor activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004950(chemokine receptor activity)|GO:0005515(protein binding)|GO:0005886(plasma membrane)|GO:0006935(chemotaxis)|GO:0007165(signal transduction)|GO:0007186(G-protein coupled receptor protein signaling pathway)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016493(C-C chemokine receptor activity) ATGTTCTTCATCACCCTAATGAGTGTGGACAGGTATCTGGCTATTGTCCACGCTGTCTAT
10 192 310 A_51_P108228 FALSE NM_007390 11441 Chrna7 cholinergic receptor, nicotinic, alpha polypeptide 7 Mm.113464 ENSMUST00000032738 ref|NM_007390|ens|ENSMUST00000032738|gb|AK157809|gb|L37663 chr7:70244064-70244005 mm|7qC Mus musculus cholinergic receptor, nicotinic, alpha polypeptide 7 (Chrna7), mRNA [NM_007390] GO:0000187(activation of MAPK activity)|GO:0001540(beta-amyloid binding)|GO:0001666(response to hypoxia)|GO:0001988(positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure)|GO:0004872(receptor activity)|GO:0004889(nicotinic acetylcholine-activated cation-selective channel activity)|GO:0005216(ion channel activity)|GO:0005230(extracellular ligand-gated ion channel activity)|GO:0005515(protein binding)|GO:0005624(membrane fraction)|GO:0005737(cytoplasm)|GO:0005886(plasma membrane)|GO:0005892(nicotinic acetylcholine-gated receptor-channel complex)|GO:0006810(transport)|GO:0006811(ion transport)|GO:0006812(cation transport)|GO:0006816(calcium ion transport)|GO:0006874(cellular calcium ion homeostasis)|GO:0006897(endocytosis)|GO:0007165(signal transduction)|GO:0007271(synaptic transmission, cholinergic)|GO:0007613(memory)|GO:0008144(drug binding)|GO:0008179(adenylate cyclase binding)|GO:0008284(positive regulation of cell proliferation)|GO:0008306(associative learning)|GO:0009897(external side of plasma membrane)|GO:0014061(regulation of norepinephrine secretion)|GO:0014069(postsynaptic density)|GO:0015464(acetylcholine receptor activity)|GO:0015643(toxin binding)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016324(apical plasma membrane)|GO:0017081(chloride channel regulator activity)|GO:0019228(regulation of action potential in neuron)|GO:0019901(protein kinase binding)|GO:0030054(cell junction)|GO:0030317(sperm motility)|GO:0030424(axon)|GO:0030425(dendrite)|GO:0030426(growth cone)|GO:0032094(response to food)|GO:0032225(regulation of synaptic transmission, dopaminergic)|GO:0032279(asymmetric synapse)|GO:0032691(negative regulation of interleukin-1 beta production)|GO:0032715(negative regulation of interleukin-6 production)|GO:0032720(negative regulation of tumor necrosis factor production)|GO:0034220(ion transmembrane transport)|GO:0035094(response to nicotine)|GO:0035095(behavioral response to nicotine)|GO:0042110(T cell activation)|GO:0042113(B cell activation)|GO:0042166(acetylcholine binding)|GO:0042221(response to chemical stimulus)|GO:0042391(regulation of membrane potential)|GO:0042698(ovulation cycle)|GO:0042734(presynaptic membrane)|GO:0042803(protein homodimerization activity)|GO:0043025(neuronal cell body)|GO:0043197(dendritic spine)|GO:0043198(dendritic shaft)|GO:0045121(membrane raft)|GO:0045202(synapse)|GO:0045211(postsynaptic membrane)|GO:0045471(response to ethanol)|GO:0045766(positive regulation of angiogenesis)|GO:0048149(behavioral response to ethanol)|GO:0050727(regulation of inflammatory response)|GO:0050728(negative regulation of inflammatory response)|GO:0050890(cognition)|GO:0060112(generation of ovulation cycle rhythm) CGAGAATTGGGGTCCTAACTCTACATTGTGATAAATGGAAGAACTCTGAGGTATCCCTGT
11 192 308 A_30_P01033363 FALSE chr7:134807861-134809001_R chr7:134808751-134808692 mm|7qF3 lincRNA:chr7:134807861-134809001 reverse strand GGGGAACTTCAAGTAACAAACATTTATTAATTAGACTTCTGAACTACCAATGGGGCAGAA
12 192 306 A_55_P2049737 FALSE CA465559 Mm.415064 gb|CA465559|tc|TC1721584 chr2:171041086-171041027 mm|2qH3 AGENCOURT_10728649 NIH_MGC_169 Mus musculus cDNA clone IMAGE:6773657 5', mRNA sequence [CA465559] ATACATAAATGATACATCTTCGCTGATCTCGGCTAGCAGTGCCATGTCACTTCTGCAGCT
13 192 304 A_30_P01024440 FALSE chr17:3213918-3257944_F chr17:3257885-3257944 mm|17qA1 lincRNA:chr17:3213918-3257944 forward strand TCTCAGGCGCGGTTTCTGATTGAATGCAGAGGTCACACGCATGCCTCCCTGTATTACCTG
14 192 302 A_30_P01025554 FALSE chr8:72663591-72671154_F chr8:72671094-72671153 mm|8qB3.3 lincRNA:chr8:72663591-72671154 forward strand AGGGTCACTCTTCCAGGAGCATTCACATAACAGTCTTTGTGCACTGAATACACTGACTGT
15 192 300 A_30_P01031558 FALSE chr17:13812666-13820504_R chr17:13812739-13812680 mm|17qA1 lincRNA:chr17:13812666-13820504 reverse strand TTGAAGGGGAAGAGCAGAGACCTCACACTGTACAGAGGCCATGCCTGTCACAGGCTAGTC
16 192 298 A_30_P01030675 FALSE chr6:67054389-67054857_F chr6:67054547-67054606 mm|6qC1 lincRNA:chr6:67054389-67054857 forward strand TCTGTTGCATCTGAATCCTTCCATTGTTTTGGAACAATGCTGTCAGATGCAAGTGCCCTG
17 192 296 A_51_P328014 FALSE NM_011991 26572 Cops3 COP9 (constitutive photomorphogenic) homolog, subunit 3 (Arabidopsis thaliana) Mm.40 ENSMUST00000019517 ref|NM_011991|ens|ENSMUST00000019517|gb|AK142318|gb|AK169747 chr11:59634853-59633613 mm|11qB1.3 Mus musculus COP9 (constitutive photomorphogenic) homolog, subunit 3 (Arabidopsis thaliana) (Cops3), mRNA [NM_011991] GO:0001701(in utero embryonic development)|GO:0005488(binding)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0008180(signalosome) CCGTGTACAGTTATCTGGACCACAGGAGGCAGAAAAATATGTTCTACACATGATAGAAGA
18 192 294 A_30_P01019108 FALSE chr3:4797557-4798821_F chr3:4797836-4797895 mm|3qA1 lincRNA:chr3:4797557-4798821 forward strand TATCTGCTAAGCATTGCAGCTCCTGTGCCCTTCTACACATTTTTATTTCCAGAGAAGGTA
19 192 292 A_55_P2056220 FALSE unmapped ATTTCTTCTGTTCCACTCTGTGCACATGGCGTTTCAGGGTACGAGGTGTAGCATCTTTAT
20 192 290 A_55_P1985764 FALSE chr11:041314267-041314326 mm|11qA5 TTTTGTTAGCATCAGGACTGTAGTGCTGTGTCACCACATGAGAGTTCAGAAGCAGCCTTT

Total number of rows: 62976

Table truncated, full table size 28789 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL13912_old_annotations.txt.gz 7.9 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap