NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL13490 Query DataSets for GPL13490
Status Public on Nov 14, 2011
Title Affymetrix Human Promoter 1.0R Array [genome build GRCh37]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Affymetrix
Manufacture protocol see manufacturer's web site
 
Description Custom probe annotation of Affymetrix Human Promoter 1.0R Tiling microarray.
Annotation based on genome build GRCh37 (NCBI build 37; hg19).
The data table contains only those probes that have a unique complete alignment to the genome, probes with multiple alignments or additional incomplete alignments (allowing 1 mis-match) were excluded.
 
Submission date May 04, 2011
Last update date May 04, 2011
Contact name Johannes Rainer
E-mail(s) johannes.rainer@eurac.edu
Organization name EURAC
Department Center for Biomedicing
Lab Biomedical Informatics
Street address Via Galvani 31
City Bolzano
ZIP/Postal code 39100
Country Italy
 
Samples (24) GSM720046, GSM720047, GSM720048, GSM720049, GSM720050, GSM720051 
Series (3)
GSE29056 Transcriptional glucocorticoid-response at the exon level and NR3C1 DNA-binding in childhood leukemia models; NR3C1-DNA binding in CCRF-CEM-C7H2 T-ALL cells.
GSE29057 Transcriptional glucocorticoid-response at the exon level and NR3C1 DNA-binding in childhood leukemia models; NR3C1-DNA binding in NALM6 precursor B-ALL cells.
GSE29063 Transcriptional glucocorticoid-response at the exon level and NR3C1 DNA-binding in childhood leukemia models: mRNA and ChIP-chip profiling

Data table header descriptions
ID probe id; index of probe in the CEL file
x x coordinate of the probe on the microarray
y y coordinate of the probe on the microarray
SEQUENCE
gc_count
chromosome
RANGE_GB Chromosome ACCESSION.VERSION
SPOT_ID
RANGE_START the start position (relative to the RANGE_GB); based on alignment of the probe to the human genomic DNA sequence (GRCh37)
RANGE_END the stop position (relative to the RANGE_GB); based on alignment of the probe to the human genomic DNA sequence (GRCh37)
strand

Data table
ID x y SEQUENCE gc_count chromosome RANGE_GB SPOT_ID RANGE_START RANGE_END strand
1568199 14 724 ATAGAATTTCAAATATCGATAATCA 5 2 NC_000002.11 105069520 105069544 -
75670 2025 34 TAAAAATTAAGTTAACATACGTGAA 5 4 NC_000004.11 164322635 164322659 +
103577 1774 47 TGGAAACTCCAAAATCTATCAACTC 9 1 NC_000001.10 55537 55561 +
2897587 1644 1337 GTCAATCCTATTTTCAAAATTCTTA 6 1 NC_000001.10 61280 61304 +
2337056 2107 1078 TTGTTTACCATTATTACTCTTGGTA 7 1 NC_000001.10 61478 61502 +
1941657 920 896 ATATTAGATTTGACCTTCAGCAAGG 9 1 NC_000001.10 564434 564458 +
3580640 241 1653 ACACTCATCGCCCTTACCACACTGC 14 1 NC_000001.10 566001 566025 +
3630838 621 1676 GGTATCTCCTCTATCTTAGGAGCCA 12 1 NC_000001.10 566913 566937 +
1782416 1963 822 TACAAATTACCACCTACCTCCCTCA 11 1 NC_000001.10 569004 569028 +
2055231 1862 948 TCCAGCCTAGCTCCCACCCCCCAAC 17 1 NC_000001.10 570065 570089 +
3141986 1285 1450 CTCAGAGTACTTCGAGGTTAAAATA 9 1 NC_000001.10 570289 570313 +
4355398 1737 2010 GGAAATGTGTTGATTTATGGAAATG 8 1 NC_000001.10 746620 746644 +
2077613 418 959 CCCTTATTACATGAAGGAGCAGCAG 12 1 NC_000001.10 750048 750072 +
4458015 386 2058 CTGTGTTCACGTCACCAAGAGAATA 11 1 NC_000001.10 752687 752711 +
473870 1681 218 GGGAAGAATGCAAAAGTCAAAGACA 10 1 NC_000001.10 752722 752746 +
3006589 180 1388 AGTCCCTGAGGACTGCCTTGGCATG 15 1 NC_000001.10 753257 753281 +
3469858 2091 1601 TTCCGCAGGTTTTAGCGGCTGCGGC 16 1 NC_000001.10 753355 753379 +
4174018 135 1927 ATTCGCCTCCACTCTCAGGTTTGCA 13 1 NC_000001.10 754182 754206 +
911418 1697 420 GGGGACAGTGTGTATTCTTCCTCCA 13 1 NC_000001.10 754362 754386 +
2819789 1822 1301 TGATGACCGAAAATTTCAGAAAAGC 9 1 NC_000001.10 754861 754885 +

Total number of rows: 3837458

Table truncated, full table size 307581 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap