NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL13276 Query DataSets for GPL13276
Status Public on Apr 11, 2012
Title NimbleGen Custom Mouse Hox Tiling Array
Technology type spotted oligonucleotide
Distribution custom-commercial
Organism Mus musculus
Manufacturer Nimblegen
Manufacture protocol Nimblegen manufacture protocol
Support glass
 
Description Custom NimbleGen tiling microarrays were designed using http://genome.ucsc.edu/MM9 NCBI37. Co ordinates of Mouse Hox A, B, C and D clusters, and several other genes were included in the design. For genes other than Hox clusters, we have included 2 KB upstream TSS and 2KB downstream TES. We have chosen probes that may match up to 10 places in the genome as necessary to fill gaps in coverage; average probe spacing is 46 bases; four copies of each probe to be placed on the array. For details about designing and manufacture http://www.nimblegen.com/
 
Contributor(s) Marulasiddappa PM, Eskeland R
Submission date Mar 14, 2011
Last update date Mar 24, 2011
Contact name Pradeepa M Madapura
E-mail(s) pmadap@essex.ac.uk
Organization name University of Essex, School of Biological Science
Lab Pradeepa Madapura
Street address Wivenhoe Park
City Colchester
State/province Essex
ZIP/Postal code CO4 3SQ
Country United Kingdom
 
Samples (46) GSM697402, GSM697403, GSM697404, GSM697405, GSM697406, GSM697407 
Series (7)
GSE28153 Psip1 ChIP using A300-847 antibody (Immunoprecipitates mainly p52 isoform of Psip1) Chip-chip from Mouse MEFs cells with H3K36me3, H3K4me3, Psip1 ChIP using A300-847 antibody
GSE43099 Gain and loss of H4K16 acetylation during ES cell differentiation [NimbleGen ChIP-chip]
GSE43103 H4K16 acetylation marks active genes and enhancers of embryonic stem cells, but does not alter chromatin compaction

Data table header descriptions
ID
SEQUENCE Probe sequence
chr Chromosome number
RANGE_GB GenBank Accession number
RANGE_START Probe start position on chromosome
length Probe length in nucleotides
RANGE_END

Data table
ID SEQUENCE chr RANGE_GB RANGE_START length RANGE_END
CHR01FS136453759 GCAAGGGGAAGCGTCTTCTGAGGGGCGGGGGAGCGGTTGCCTTTAAGTAG 1 NC_000067.5 136453759 50 136453808
CHR01FS136453804 AGTAGAGATCCCTCTCAGGCCCTAGGTTCTCTTGACTAGGTTGGCAACCG 1 NC_000067.5 136453804 50 136453853
CHR01FS136453849 AACCGCCGACTCCCTCAGCGTCTCTCTGGGTTGATCTGTAGCATCTCATC 1 NC_000067.5 136453849 50 136453898
CHR01FS136453884 CTGTAGCATCTCATCATTTAGGATCACTACCAGAAATGGAGGAAGCAGCA 1 NC_000067.5 136453884 50 136453933
CHR01FS136453929 CAGCACTAGTAGACCTTGAAAGTTGGGAGAGAAGATGACTAGGTCATAGT 1 NC_000067.5 136453929 50 136453978
CHR01FS136453989 ACTTCCTAAGTTCGTACCTTCCAGTTACATACCCACAATTCATGTCCAGAG 1 NC_000067.5 136453989 51 136454039
CHR01FS136454034 CCAGAGGTCTGAAAATTATAACCTACTTGGTTTGTAGGATGCTAACGTCAAAGG 1 NC_000067.5 136454034 54 136454087
CHR01FS136454069 AGGATGCTAACGTCAAAGGTGAAAGTACTGTCCTTTCCCAAAGCAGAGAA 1 NC_000067.5 136454069 50 136454118
CHR01FS136454114 GAGAACATGACAGAAAGTCAACTCCAGGAAGACCCCCAAACACACACAAC 1 NC_000067.5 136454114 50 136454163
CHR01FS136454159 ACAACGTTTATAACATCCAGGGTCAGGGCCAAGAGCGAAAATAAAGGATTTT 1 NC_000067.5 136454159 52 136454210
CHR01FS136454219 TCAGTCAATATGACAGGTCATCTGAAATCTTAGCCTTTGGGAATGAGGTCAG 1 NC_000067.5 136454219 52 136454270
CHR01FS136454289 TTCCAGGCCAGCTTTGGCTACAAGTATGCAATCCCATTTCAATTTTTCCC 1 NC_000067.5 136454289 50 136454338
CHR01FS136454339 CCTCAATACATTATCACGGAAAAAAAAATCAGCAAGGTTTAAAAATATGTCAAGC 1 NC_000067.5 136454339 55 136454393
CHR01FS136454414 TAATCCTAGCACCTCCGAGTTAGAAGCCAGCCAATATGTGAGTTTCAGGC 1 NC_000067.5 136454414 50 136454463
CHR01FS136454474 TACATAGTGAAACCTTGACTCAAAAATGTGGTAAATTCTATACTTCTTCCCTAGG 1 NC_000067.5 136454474 55 136454528
CHR01FS136454519 CTTCCCTAGGTTTCCCACGATTTTATAACCTGCTGTATCACCTCATTTTACAATGA 1 NC_000067.5 136454519 56 136454574
CHR01FS136454579 TTTTTAATGAACAGATTATTGTCTAAGACAATATTATTGTCTTATTTTATTATTAT 1 NC_000067.5 136454579 56 136454634
CHR01FS136454629 TATTATTTAAGACAATATATGTCTTATTCAGGCTCCAAATCCCTGTAGAGCTAAGAAAA 1 NC_000067.5 136454629 59 136454687
CHR01FS136454674 TAGAGCTAAGAAAAGTTTTGCCTTCTTCAAGAATTGCTGAACTGTTTTAGAGGCCAG 1 NC_000067.5 136454674 57 136454730
CHR01FS136454709 GCTGAACTGTTTTAGAGGCCAGGTACTTCGATAGAGCTTATTAAAGACTGG 1 NC_000067.5 136454709 51 136454759

Total number of rows: 179493

Table truncated, full table size 18785 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL13276_100428_PM_MM9_Hox_plus_ChIP.pos.gz 1.4 Mb (ftp)(http) POS

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap