NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL10754 Query DataSets for GPL10754
Status Public on Dec 01, 2010
Title Arborea spruce 11K cDNA microarray
Technology type spotted DNA/cDNA
Distribution non-commercial
Organism Picea glauca
Manufacturer Project Arborea, Centre d'Etude de la Foret, Université Laval, Québec, Québec, Canada
Manufacture protocol The 11K microarray was designed based on the white spruce (Picea gluca [Moench.] Voss) expressed sequence tag (EST) assembly. This assembly comprised 16600 unique contigs sequenced from 17 cDNA libraries, which represented different tissues at a diverse developmental stages and growing conditions. 10400 nonredundant sequences were selected and printed as double, side-by-side on the microarray slide with 4X12 subgrid layout and 132 spots per subgrid. Details of the microarray manufacture and quality control are described in Pavy et al. (2008) (PMID 18811621).
Coating aminosilane
 
 
Contributor(s) Pavy N, Boyle B, Nelson C, Paule C, Giguère I, Caron S, Parsons LS, Dallaire N, Bedon F, Bérubé H, Cooke J, Mackay J
Citation(s) 18811621
Submission date Aug 02, 2010
Last update date Dec 01, 2010
Contact name Chelsea Ju
E-mail chelsea.ju@ualberta.net
Organization name University of Alberta
Department Biological Sciences
Lab Dr. Janice Cooke
Street address CW 405, Biological Sciences Centre
City Edmonton
State/province Alberta
ZIP/Postal code T6G 2E9
Country Canada
 
Samples (30) GSM604005, GSM604006, GSM604007, GSM604008, GSM604009, GSM604010 
Series (2)
GSE23519 Molecular events of apical bud formation in white spruce
GSE31090 Integrated transcriptomic and proteomic profiling of white spruce stems during the transition from active growth to dormancy.

Data table header descriptions
ID
BLOCK Subarray
ROW Vertical position in subarray
COLUMN Horizontal position in subarray
GENE_ID (MNC) ForestTreeDB gene identifiers
GB_LIST GenBank accession numbers for spotted expressed sequence tags
CLONE_ID_LIST Genome Quebec cDNA clone identifiers (https://www.gydle.com/arborea/gcat/)
EST_ID_LIST (GCAT) Genome Quebec expressed sequence tag identifiers (https://www.gydle.com/arborea/gcat/)
EST_ID_LIST (MN) ForestTreeDB expressed sequence tag identifiers
BLASTX_HIT_ID Blastx hit identifier versus UniRef100 database
BLASTX_HIT_E-VALUE
BLASTX_HIT_DESC Annotation associated with the BLASTXHit_Id column
GO_MOLECULAR_FUNCTION
GO_BIOLOGICAL_PROCESS
GO_CELL_COMPONENT Gene ontology terms under the cell component domain
PFAM_HIT_ID Pfam family identifier
PFAM_E-VALUE
PFAM_HIT_DESC Pfam family description associated with the Pfam_Hit_id column
SMART_HIT_ID SMART domain family identifier
SMART_P-VALUE
SMART_HIT_DESC SMART domain family description associated with the SMART_Hit_id column
SEQUENCE Nucleotide sequence

Data table
ID BLOCK ROW COLUMN GENE_ID (MNC) GB_LIST CLONE_ID_LIST EST_ID_LIST (GCAT) EST_ID_LIST (MN) BLASTX_HIT_ID BLASTX_HIT_E-VALUE BLASTX_HIT_DESC GO_MOLECULAR_FUNCTION GO_BIOLOGICAL_PROCESS GO_CELL_COMPONENT PFAM_HIT_ID PFAM_E-VALUE PFAM_HIT_DESC SMART_HIT_ID SMART_P-VALUE SMART_HIT_DESC SEQUENCE
1 1 1 3 MNC5700306 CO487635 GQ0254_J18 GQ0254.B7_J18 MN5263373 N/A N/A N/A N/A N/A N/A PF07134 4.00E-11 Protein of unknown function (DUF1383) SM00111 2.70E-11 C4_2 TTTCTGAAACCTTTTTGACATATTAACAAATTACAGAATGCACAACGGAATTCCGGATTCTTTACTAAACCCTAAAACCTAAAGCATTCCATAACGGTTGTCCATTACAGAACCTGATTAGAGTTTTAAGAATGTACAGAAAGTATACCAGAAAGTTGCACTTAAACGTAAACCCTGGCACATTCAATGACAGTTTCCCATTACAGAACCTAATTAGGGTTTTAAGAATGTACAGAATGAATGCCAGAAATTTACACCAAACCTAAGCCCTGATCAATTCCATAACGGTTTTCACAGAACATAACTTCAACCCA
2 1 1 5 MNC5695396 DV978893 GQ0174_M21 GQ0174.TB_M21 MN5192233 UniRef100_Q9FVD3 1.77E-107 Hexokinase GO:0004396 hexokinase activity GO:0005524 ATP binding GO:0016301 kinase activity GO:0004340 glucokinase activity GO:0016740 transferase activity GO:0000166 nucleotide binding GO:0030528 transcription regulator activity GO:0003677 DNA binding GO:0005515 protein binding GO:0004872 receptor activity GO:0006096 glycolysis GO:0045449 regulation of transcription GO:0000074 regulation of progression through cell cycle GO:0006007 glucose catabolic process GO:0006006 glucose metabolic process GO:0046835 carbohydrate phosphorylation GO:0001678 cell glucose homeostasis GO:0006000 fructose metabolic process GO:0009749 response to glucose stimulus GO:0019932 second-messenger-mediated signaling GO:0005634 nucleus GO:0005739 mitochondrion GO:0005622 intracellular GO:0005829 cytosol GO:0005741 mitochondrial outer membrane GO:0005625 soluble fraction GO:0016020 membrane GO:0005737 cytoplasm GO:0016021 integral to membrane PF03727 1.80E-103 Hexokinase SM00186 9.90E-36 FBG_2 GCTCAAATCATACGCTGCCTCAATGTGACCAGTAGATACTAGAAACACAGCATTTGAATATCATGACAAACAT*TCTGGTGTCTAATATCCTGCTGCCAAGAAAATACATACATAAATAGTAGCAATGCCTCAAGCACGGCAACTGTAAAAGGTCACTACTCCAGCCATGAAATTAAAACTATAGCCACATAAAACTTAGCCACTTTGCATTTAATGGAGAATGTATATCACCCAAAATCCAGATTAAAGTGGGCAATTAGAGAGTCCTTTTTCAGCCCTGCAATTATTACCCATGCAAAGATCATGGGTTGGCAACTCTAGAATATACTTCTACACTAAGCCTCCATCAAGAAAAAACATTTTGCTTGGAAGCCAGATGCTTGACAGACAGCTCAACAATTAGTTGCTCTGTATCACAAGTCAATTTATTAGACTTATGTGGCTACAGTAGCAAACAGTTTTGATAGTGTACTTGGACTACAGAAATGTCTGTAGTATCTGCATCAAGATTTCTTTGAATACCTTGAGTTAGATGCAGCAAGAAGAGTAGCCCCAATCCCTGAACCATCACTTGAAAGTTCTAAAACCACAGTTTCCGAAACCTCACTTCCAAGCAATTCTTTAACAGCACTTTGCATATTTTGTCTGAAAAATGAATAGTGCTCATACAGACCTCCATCAATTGCCACAACAGTCCTCATTTTACCTGTGTCTCCAATGACATCTCTCCCCAATTTCTTTAGTATGCCCACTATTCCAGCTCCTGCTAAACGAGCAGCACGAACTGCTACAATGCCGCATAGTTCAACTAC*AAGTTTTCGTGTCCTCAAAGGAATGTGTGATATCCCAAATACATTCTTCAAAGTATTTTCAACTACTTTAAGGTCAGGTGAGGTGTCCTGGTGCATAGCAGATATATTTGGGGTAGTTAATACATATGGCTCTCTAAGTCTGGATGGAATGTTATCTCCAAATAAAGCAGCATCTTCAGCCAATTTCAGCAATAATCTTCTTACAATCTCTCCCAAATACATTCCTGAGATTAGCTTTTCAAAGATATGATCGCCGGGATTTATACTTTCAGCATCAAGAGCTTTATCAAATTCTGTTACTGGGAGATGAGAAGACCAAAAGTTCCCCCACTCTGTGTTGATAACCATATAGCCAGATTTTGGGAGAAGACCTTGACATTTTGGGATTGCATCTGCATGTTCCACGTAACAGGCATTTGTACCAGTGCCCAAAATAACAGCAATCATAACATCCTCATCCCGATATCGTCCTCCGGCCAATGTCCCCACTGTATCATTTACCAGGGCAGAGACATGCATATCCAGACCTTGTCTTTCCATGGCCTCCTTTAAGGCTACCACCACATCCTTGCCAACCATTTCTGAGACAGAAAACCCCTTGCTCCATTTGATTAGTGTGCCAGAGGCAATTGCTGTTTGATGCACTGGGAAAGAGAAAGTGAAACCGAGCTCCCTTTGTCGGCCAGGTTCTAGATAGAAGTTTTTTCCTTCGCTTGTGACAAATTTTGCTAGTTCTGAAGCAATGTAATCAAACAATTCCTTTTCTGTTCCAACCATCAGATTTGCAGGAATAGTAACTTCTGTAAACTCTTTATCAATTACTCGTCCTTCCTTTCCACCCAATTGAACACGTAACACCCGGAAATTGGTTCCCCCGAGATCCAAAGCATAGAAAAGGCCTTTCTCATCCCCCGTAGGCAAAGTATCAACGTAGCTTATGACCATCTTGAGGAGGTTACTC
3 1 1 7 MNC5701646 CO473096 GQ00412_A01 GQ00412.B3_A01 MN5258579 UniRef100_Q1T402 0 RNA-binding protein Lupus La GO:0003723 RNA binding GO:0006396 RNA processing GO:0006405 RNA export from nucleus GO:0005634 nucleus GO:0005737 cytoplasm GO:0030529 ribonucleoprotein complex PF00689 1.60E-21 Cation transporting ATPase, C-terminus SM00715 1.10E-16 la GCACGAGGGGAAACCGGAGTGAAGGGATTTATGCCTATGCCTGGTGGTAATGAGTATACCAGGCCTCCTTTCCAGAGAGGGGTTAGATCCTTTATTCCACAAGGAGATCCCAATCAATATTTGAGCAGCTATGGACATAGGCCCAACAACATACACGAGCAAAGAAGGCCTAACTATGATTGGAATTCTCAGCAAGCTCTTTATGGTACAGATAATACTGCAATGTATCAAAGAGTTGGACCAAGGAATATGGGGAGACCACCTCCCCCATTGGTTCCTCCAAATCATGGTTTAACAAATCATCCCGGTTTTCATGCTATACCAACATACTATTTTCCGCCAAGAACACACCTAGATAGTGTCAGAGGTGGACCTTATTTTGCACCGGCTCCACCTTCTGGTGTGTTCTTTTCTGGACCTGATCCTCATTTGCGTGTTAAAATACTTAATCAGATTGAGTACTACTTCAGGTTTGCTCAGACATACTCTTTTATTAGTTATGGCCCATTCCCATGAACGAATTAGTATGTTAATTCATCAAAATTTGATTTCTTTGATTTTTTAATTCTATGACAATTAGATCATTCTTACTCCCATCACAGTCAATCAGATCGAGTACTATGCCAGGTTTTCATGCGCAGGCTCTGACTATTGCTGGTCCAATAGTGTGAACCAATTGAAATGTTTAATAACTATAAAAATCGTTTTCCTTGAACTTTCTATCTGGTTGCAATTAGTTTGGTCTTACCCCCATTGTTTTGTGCATTCTTTG
4 1 1 9 MNC5697946 CO484417 GQ0205_P04 GQ0205.TB_P04 MN5235661 UniRef100_UPI000065E183 1.86E-63 Homolog of Brachydanio rerio Tuba1 protein. GO:0000166 nucleotide binding GO:0003924 GTPase activity GO:0005525 GTP binding GO:0005198 structural molecule activity GO:0005515 protein binding GO:0005200 structural constituent of cytoskeleton GO:0003824 catalytic activity GO:0046982 protein heterodimerization activity GO:0007018 microtubule-based movement GO:0051258 protein polymerization GO:0007017 microtubule-based process GO:0000226 microtubule cytoskeleton organization and biogenesis GO:0007094 mitotic spindle checkpoint GO:0051301 cell division GO:0000910 cytokinesis GO:0007283 spermatogenesis GO:0030154 cell differentiation GO:0030467 establishment and/or maintenance of cell polarity (sensu Fungi) GO:0005874 microtubule GO:0043234 protein complex GO:0005739 mitochondrion GO:0005737 cytoplasm GO:0005634 nucleus GO:0005829 cytosol PF03953 9.90E-80 Tubulin/FtsZ family, C-terminal domain SM00008 8.30E-21 HormR_1 GCTGATGCGGACGAATCCGATCGAAGAGCGCCGCGAAAACCGCCGCTGCAAGCAGCAGCGTCTCGCCGCGGCGACTCTTGAGCCGCCTTGGCCCGTGAGTGAAGCGCCGGGGCCAGTTGCTCGCGGCGGCCCATCCCAGGGGGTCGGGGCACGGAGTTTACGCCTCCGCGCCCTCCTCCCCGCCCTCCTCGCCGCCCTCCGCAGCCTCAGTGCTGATCTCCTCGTAGTCCTTCTCCATGGCCGCCAGATCCTCGCGCGCCTCCAGGAACTCGCCCTCCTCCATGCCCTCGCCGACATACCAGTGGACGAAGGCGCGCTTGGAGTACATGAGGTCGAACTTGTGGTCCATGCGCGCCAGCACGCCCGCGATGGCGGTCGTGTTGGACATCATGCACACGGAGCGCTGCACCTTGGCGACGTCGCCGCCCGGCACCACCGTCGGCGGCTGGTTGTTGATGCCCACCTTGAACGCCGTCGGGCACCAGTCCACGAACTGGATGGTGCGCTTGGACTTGATGGTGACGATGGAGGCGTTGACGTCCTTGGGCACGACGTCGCCGCGGTACATGAGGCAGCACGCCATGTACTTGCCGTGGCGCGGGTCGCACTTGACCATCATGTTGGCGGGCTCGAAGACGCCGTTGGTGATCTCGGCCACGGAGAGCGACTCGTGGTACGCCTTCTCCGCGGGGATGATGGGCGCGTAGGACGCCAGCGGGAAGTGGATGCGCGGGTAGGGCACCAGGTTCGTCTGGAACTCCGTCAGGTCCACGTTGAGCTGGCCGTCGAAGCGCAGCGAGGCC
5 1 1 11 MNC5692408 CO475699 GQ0069_P19 GQ0069.TB_P19 MN5243004 N/A N/A N/A N/A N/A N/A PF02678 7.80E-17 Pirin SM00476 5.80E-18 dnai3 GCACGAGGCTCTTGTGGAGTGCACAAAGCAACAAGCAGCGGCTATGTCGATGTCGAAGGACGGCCGACCAGGACCTCGGAAGCAAGGCTATGGCTCGACATATTCCTGCATCAAATCCTGCGCCGTCACCGCCGACGCTCAGATCGCAATTCCGACTCGCGCCCGACAATCAAGCAGGCAGAGCAGCAACGACGACGACAAATGGAGAAAACAGAATGCGTTGGCCATTATCTCGTCGGATCATCGTCGCCACAGAAGCCATGAGCATCTCTTGTATTACGAAGCCCAGTCCGACAATCCTAAATTTCTCCACGGCGATCCGAAGCAATTGCAGAGATCAGAGAGGCGGGACTTGGTCCCGCACAAACGGCAATTGCGGCCTGCGTTCATGGAATCTTGGGATGTGGAGCTTCACAAGAGCCTTGTCCGCCATTAAAGCTAATAAGAATCTCCTGCGTTATTTATTTATTATGTAAGTCTATTGCTGATGCATTCC*ATATGTATC*AGATCTGG*ATTTTTATTTTGTAAGTTTGGACTTCTGTTTCATGAAATATAAGATAATTTTAAGTGTTGTAATT
6 1 1 13 MNC5687898 CO486136 GQ02011_J24 GQ02011.B7_J24 MN5252454 N/A N/A N/A N/A N/A N/A PF00390 3.60E-15 Malic enzyme, N-terminal domain SM00476 8.70E-14 dnai3 TATGATATCAAATTATCAATGCCCTCTCCCCCTTTTATGAAAAACAATCAGGGTTTGTTTGTCAGGTCTTGAACTAGAGGCAGAAGGTCTTTGTCGTGCATCAATGGTGGTTGGAGGACTAGCTACTCCAATCTATGTAGAAAGCGGTGTTCCACTTTCAACTAGCTCATCATCCTCCATGGTGATGGATGAAGCTCCTTCTCTTGTTGATGCTTTTGGTCTCCTTCATCTAACCATGCAAATGCCTCATCCAAGAGAGGCACCTCAACCTCCACCCTCCACTTAGACAATATATCAATATTGTCCAAAGAAATGGCATCCACGTCTGGCTCTTTCTCTATATACCTCATCCAAAGCCGGAGATTGTAGTGGACGTACACCAAGTCATTAAACATGGGAATGCCAACCTTGAATAAAATCGATTGAAAGATCAACTCTGGTGGAGTTCATGACAGCGGGT
7 1 1 15 MNC5693660 CO474191 GQ00410_A06 GQ00410.B3_A06 MN5259803 N/A N/A N/A N/A N/A N/A PF07731 2.10E-23 Multicopper oxidase SM00558 1.70E-22 cupin_9 GCACGAGGACCATGCAAGGCAAAGTCTTGAGTCTTGGGAGATTCCGTCGAGTCTAAGTCAGTTTTTTTTAATTTTTTTTTTTTAATTAATTAATTATTTAATTAATTAATTAATTTTGAGCTTAATAATGTAAAAACTTCGTCTTTGGGAGAAAGATAGGGGTATTTGTGCTCAAAATGAATGGAATAGCACTCCCTACACCCACTGGCCAAGTTTCAGCTCAGTCGGACTATTTTTGCTTTGTCAAAGTCCACTTAGAGTCAGTTAGGGCAAAAATAGCAATTTTAATTGCTAAAGTGATTTTATTAAAAAATCACAAAACTATTGTAAATTGGAGTTTAATTAGTGGATGCAAGGTGGAAAGTGGCAAGAAGTACCCTCCTAAACAAACCCAACCCTTCCCCCACCTTTTCCTAACTTAATTTAACTCATTTATTGACTTTTTGACTAATTTCCCTCTTGCCCTAGGGGGAAATTCGACCCATGACTGGATAATTCACTAAATAAATCCTCGAAACGCCAAACGAGGCTACCACACATGTGGTACGCCTTCCTAGACTCACTCTAGACCTAACCCCTACCAAAAACCTAACTCTAAACCTATTCTAACCTCTTACCCACCTTCTACATTCATTTTTCACACCCCCCAAGGGAAAGTGACGTTTTTCATTAGTGGAGGTTGTTGTGACTTATTTGGGGCCCCCTCTCATGAGTTATGACTCCCTTTGACCCCCACATTAATTCCTAGAATGGTCCCAATCAATTTTTCTCATTAATTCTCCTCCATTCATTCATTTTCACACTTTTTTTGGGCCCTCCAAGGGGAGTTACGTCCCCCCTTTTCTAGAAACTCCACAAATGATTTTTTAAAAAATTATTTGGACCTCTCACCTTCCTTGGCATCAATCCCAAGGCCTCTCACACCTCTTTGCTTGATCCCAACACCTTCTAATAGATCTACACCATAGATCTAGTTTTCAAACCCTAGATGGTGTGCCCCTTTCTTGAGATTTGTTCAATCTCTCTCAAACTAACACTTGGCATTGATCCAAGACCCTTCCTTTTGCCTCTAGGGGTATAAAAGAAACCCCTAGCCTCCTCATTTCTTCACCTATTCTTGTGCTAACTCTATTATGCAGAAATTTCTCATTGCTCCATCTTCTTGCTCTTGCCATCTTGCCATCCATTCATTGCTCTTGGAGATTTTTGGAGGAAGATCTACTCCAACATCTTCACATTTTGATGAATAAAGGAAAACGCTTTGGAGGCCAA
8 1 1 17 MNC5700028 CO481293 GQ0168_F24 GQ0168.B3_F24 MN5269880 UniRef100_P93370 3.18E-69 Calmodulin-binding protein GO:0005516 calmodulin binding N/A N/A PF07887 2.10E-126 Calmodulin binding protein-like SM00129 1.40E-23 kinesin_4 GGAAGTTTAGGCTTGGAGTAAAGGTTGCATCAGGTTACTGTGAAGGCATGCGTATTCGCGAGGCTAAGACAGAAGCTTTCACTGTGAAAGATCATAGAGGGGAACTGTACAAGAAACATTATCCACCGGCGTTACAAGATGATGTTTGGAGATTAGATAAAATTGGTAAAGATGGAGCATTTCACAAGAAACTTAATAAAGCTGGGGTTTATACGGTTGAAGATTTTTTGAGGCTTGTGGTTAGAGATCCTCAAAAATTGCGAAATATCCTTGGAAGTGGTATGTCGAACAAGATGTGGGAGAGTACAATAGAGCACGCAAAAACTTGTGTCCTCAGTGGGAAACTCTATGTCTACTATACTGATGAGACACGGCATGTTGGTGTTATATTCAATAATGTTTATGAACTTGCGGGCCTTATTGCGAATGAGCAATATATTCCCGCTGAATCGCTTTCTGATAGTGAGAAGGTGTTTGTTGATTCCCTGGTCAAGAAGGCATATGATAATTGGATGTCTGTCATTGAATATGATGGCAAGGCATTAGTTGGTCCAAGGTCAAACAAGAAGGGAAATAGTTCTCGTTCAGAAGCTTCAATGCCCACCATGCCATATTCTGCTGCTTATAGCCAGCAAGCTCTCTTAACTCGTGAACCGGTTGCAATGCATCCTGAACAAGCTCCAGGAAATGCTGGGTTAACTGTAGGTGGTAGTTCTACAAGTTCAGTTTACGGCGAGAGATCAATTAACAGATTTGCAGGACAACCTCAGCAATTGACGACTAACAATCAAATATCTTATGGCAATCTCCCTTACAATAATGCAGCAAACCAGGTGGTAGTAGGATCATCACACCATAGTGCACTTCCTGGAACAGATTCCGTTGTTGGTCTTGCGCTGGGGCCTCCACAGTC
9 1 1 19 MNC5689062 CO476225 GQ0067_E15 GQ0067.TB_E15 MN5244616 UniRef100_Q1RXI3 2.18E-06 UDP-glucuronosyl/UDP-glucosyltransferase GO:0016740 transferase activity GO:0016758 transferase activity, transferring hexosyl groups GO:0008152 metabolic process N/A PF04161 1.40E-24 Arv1-like family SM00532 8.70E-17 ligaN3 ACGAGGCCCGTAGTGGGATTCCCATATTTTGCCGATCAGTTTCTCAACTGCAGATTCGCCAAGGAGGTGTGGAAGATCGGCCTGGATTTTGAAGATGTGGATCTGGATGACCAGAAGGTGGTCATGAAAGAAGAGGTTGAGGGTGTTCTGAGGAGAATGATGAGAACAGCGGAACGAAAGAAGATGAGAGACAACGTTCTCAGACTGAAAGAGTCCGCAGCGAAGGCCGTCCTCCCCGGAGGATCTTCTTTTCTGAATTTAAACACTTTCGTTAAAGACATGATGACGGGTAAACGACGCGGATCCAAAAATGAACCCATGTGAGTCGGATTTCACAAGATGTCATGAAAAGGCTCGGTTATTTGAGAATAAGATATTGATCTCTATCAGAATTCTGCCTTGAGTCCAGGGCCCGGTCGTATCTGAACAGGTACGGGGAGAGCTTTCTAACCTCTCACGTTTTACTCACCCGTGGCTTTACTGGTGAAAGCTAGTATCAATCTTTTAGAGAAAAATACTATTAGAGGTTGAACATAAGGATTATTATCTTCATCAACACTCCTTCTATGGTTTGGATGACTTCATCTGATTCAGAATTACACATTGCATGGCGTGGTAGATATGATCGTGAAGTATCTATACTCTAATGGTTCCCGTTTCATATATTGTTTTTCTATATATGACAATTTTTAAAATTTATGTTAGCTGTATTTTTTATTCTTGTTTTGTTTGAGTTTATATAGCTCAGTTATTTCCCTTTGTATAGTATTGACTACTTCAGAACTTCTTCATGTAATAGTTTTGTATCTTCTTT
10 1 1 21 MNC5700525 CO487871 GQ0254_A01 GQ0254.B7_A01 MN5264106 UniRef100_Q1RUQ0 0 Nonaspanin GO:0005215 transporter activity GO:0006810 transport GO:0016021 integral to membrane PF02990 3.40E-12 Endomembrane protein 70 SM00002 6.30E-11 myelin-fin ATGTAGCAGCAATGTTTATGCCAAACAAAAATATAGCAAGGTACAAATTATCTCTGTGGAAATCCATCAAAAACAAGTTGGGCATACCAACTCTGCATACCCAATATAGAGCATGCCAACAATTGCCAGTGAGATCACAAAAAGTACAGACATAGCAAGTCATGCACCTGTACCCACTAATGCTGACAGCGAGACCAAGTTTTGTGGTGATTACAAAACGTCTCCATGAACAAAAATCCAACCC
11 1 2 1 MNC5701926 CO486471 GQ02016_I12 GQ02016.TB_I12 MN5253753 UniRef100_Q9LPT9 3.26E-34 T22I11.13 N/A N/A N/A PF04759 8.50E-117 Protein of unknown function, DUF617 SM00714 1.50E-16 litaf AAGCCAAGAAATAGTACAATTTTTTANTCATCAAGACCTATAGAAGAAAAACGCTGAGTTGCTGCCCGGTGATTCCATCGGGATTGATCATATGAAAGGACTCAGAATCAGAAGACCCAACAACTCGTTCATAAGTTGCTCTCATATACATGAGCTCGCCTTCATCTCCCTTAGTGACAGTGGGCAAAACTCCTGCCCCGACCGATATGGACTGCATCACCTTCAATACGGCTCGGTCGTTCTCTGTAACATTGCGTTTTATAGCAAAACCCACCTTGCGTCCATTGCAATACATGGTCCACACAGGAACCGAGAACAAAGAGCCATCGTGGGTGCTCTCTTTGTCACACTCCAGAGCAATCCTGAGCAGACCGTATTGCATTTCCTTTGCTAACAGGTAGGTCGGCATGGCAAATTCCAGGAGGAGAAGATTAGGTCCGCGACGATCTTCTTGAATACAGAAACTCACTCGGCCTTTCCTGAAGCCGAAAATTGTGCCCGTAACGGTCGGGCCAATAGAGGATTCGGAGCTATCTTGGTCTTCAACAGAGCCACTGGTCATGGATTGGCACGATGAGCCACAGCAGGGAACCATGAATTCCACCAGAGATCTCAATGATTTCCAGCAGCGAACGTCTTTTTCACAGTCCACGGATGTCGTGCGATCTATGATCTCCATTGCATTCCGCTCGCTGCTAATATCAATCATCCTCATGTTCGTCGATCAAACCGTTCAGAAAACAAGACTGGGACCAATCTGAAAACAATTTATAACCAGTGAAGATTAAGT
12 1 2 3 MNC5693825 DV989981, DV976216 GQ0068_L13, GQ0224_B19 GQ0068.B3_L13,GQ0224.B7_B19 MN5242564,MN5250017 UniRef100_Q9FIZ2 2.87E-12 Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K23L20 N/A N/A N/A PF08293 2.40E-49 Mitochondrial ribosomal subunit S27 SM00793 4.70E-28 agrb TGAAAGTATAACAACTTTGCATTTAGATTGTTTTACGGAGGCAAACTATTTTAGAAACATTCCAGACTCCAAATCCATTCCTGGTAGATTGACTAGCTTTTAGGTAAAACGAGCAATAATTCCGCCATGGTAAAACTAGTAACAATTCCATTGTATGCAAGACTAACAGTATCTTATTTGACCATTCAAATTACTCATACAGACTAAAAGTCACATGGATAGCCTGCAAATAATTGAGACACTATTACACAATAAATGTTTACACTGATGATCTAAAGTTCAGTAGTAAGGAAACTTGGCAACCTAATCTACTTTGAACGTTTTATGGCTCGTTTTCCATGGCCCTTCTTTGGAGGTCCTTTTCCTCGTCGTTTCAACATTTGAAGCTTTTCCAGACGCTCTTTTTCTGATCTGGCAATCAACATAGGGTCATCCTTACAGATATCGTCTGGGTACCATTGAGCGACCTGTTCGCCAATAAGCTTCTTCCGCAGGATTTTATGGGGTGATCTCTGACCTGTGGGATTGAGAACATGTCCAAAAATCCTTGCCCTTGCTTCTGTCACTCCCTTCAGTGCAGCCTCTTTTAAAAGCTGCTTCAAACTCATTTTTCGCTGCATATATCCTAAGGCGGGCGATCTCCTACTCCTGAACCTGTTTAACACCACCGCGACTCGGCTGGGATCAGACACTGGAGTAATCAGCAGGCGGTCGCATGAGGCGAAGGTAGTCATACATATGTCACTGCCCGCGAGTGCTCCTCCGACCCTCCTCAATCTCACCATCGATTCAGCTGTCTCCCGCATCCATCGCATAACCAATCTCAATTCCATTCCCGACGACATCGTCCTCGATCTCTTCCGGAAAACATTGCAAGCTGGAAAGCTGACTGAAAGAATCTTGATGGTTTTCATGGCAACGGGCAATGAGCAGGTTCAGGCCTTTGTCAAGGAGAAAAATATTCGAACTGTTTTAAGGCCAATCCTACCTACACGATGTTCAGAGAAATTTTAAGTGTTCAGCCAATGATGGTTTTCAGACCTCTATTTTATGGTGATATGCAACCTTCTCATTATTTTGAATATTGGTGTAATATGATTTCATTAAGCACATCTATGGCTGGTGTGCATTGATTGGGCAGTGCTTTATTTTGTGTCTTTCACCAGTGTGAATCTTGCATTTATTCATCACCATAGATGATAGTCTCTTACTAGTTTGAGTTCTAATACTTTGTAGTTCTCAAAATAAGCAAGGGAAACTTATATCTATGATAATGTATTAGCTAGATGAATCACTGGCAATGTAAATAAAAAGTACAGGACAATCCAATGAAAATTTAAAGCTGA
13 1 2 5 MNC5690300 CO485996 GQ02011_D21 GQ02011.TB_D21 MN5251973 N/A N/A N/A N/A N/A N/A PF05159 6.80E-21 Capsule polysaccharide biosynthesis protein SM00186 5.40E-19 FBG_2 TTCCTCTTTTATTATATTAGAAGACTGATATCCATTTTTATTATATTAGAAGACTGAAATCCATTTTTATTCTATTTTACATTATCCACCCAAGTTACTTGTGACAAATCTTATCCATCCCATCCAACACACAGTGTAGAGTGTATTCATTTTAGTTTATTAGCATTACCCACCGAAGTTACTTGTGACCAATCTTATCCATCCCATCCAACACACAGTATCGAATGTACCTAGAGAACACCCACGTTGCATGTGACAAATCTCGTCCATCCCATCCACTACCAGGTGTATAGAGTGCACCTAGCTTCTCTAGGTGCAACAATGCTAAAAGGCCTGTGGCTGATCTATATTGATGTCTATGGAACAATCTCTGTATGGTAATAGCAACTCATTTTATTTACCAAAAACACCCTTAAAATCATCCATCCGTATCCGAGAAAATCTTGATCCGACCTCGACTGTCTTCCTGGTCACAAAGGTGTTATGAATTTCCCATGGCTGGTGACCGAGTCAATACAAATTCAAATCCTGTACTAACCTTCCGACTCCTAAAACACGCATCTCATTATTTAGAGTAAATTTTATATGAATTCACGGCAGGAAACCTTGATATCTGCCAAATTTGGCAGGCGCTCTGACCGCCAAAATCCAGGACGGAAATAGAGGGGAAAGTGTCAAATATTCACTGGTTCGCTAACTAATTAATTATCAAGATGCTGCCTTGGAGCGCTAGATTTCAAAATCTCCGGCATCAATGCTTTAAATTATAGGCGAGTTTCTTTGCTT
14 1 2 9 MNC5689816 CO486661 GQ0209_F09 GQ0209.TB_F09 MN5257466 N/A N/A N/A N/A N/A N/A PF01030 9.10E-22 Receptor L domain SM00139 1.40E-19 MyTH4_1 TACCCAAAAAATTTATGAGAGCTAAAATAAAACATAACAATGTTATGTTTTCCATATATGCAATTCTCATAGAAATCAAATTCAAGAGTATAATTATTCAATCCATCAACAACATTTTTGTTTTTCAGGGCATGTATGCCCTTCTCAGATATATGGCCCAATTTTTGGTGCCATAGCATTTTTTCTCTATAGGCAACTTGCTTTTAAATATGGCCCAATTTTTGGTGCCATAGCATTTTTTCTCTATAGGCAACTTGCTTTTTTAAATATGGCCCAATTTTTGGTGCCATAGCATTTTTTCTCTATAGGCAACTTGCTTTCTTAAGAAAGAGCTTGTTCAATAGGTTTTGACTATGAAGATGTAGATCCTATAGATATCTCCACTACACAAACCTAAGAAATATTAAACTCCATAATGCATGCATAAATCTATAACAAAGTGCCCACAGGAACACCCTTAGTGAGTACCATAGCTCATAAATCTATAACAAATTGCCCATAGGAACACCCTTAGTGAGTACCATAGCTCCTGAGACCATCTTGCACCCCTTTGTGAGAGAAAATAACCTGCATACCTGTATTCCCACGGCAGCAGGGACTGATACGCAGCAAAGAAAATATATACTGGAAGTTCATTATTGACCAGAAAAGACTATTATTATTTAGCTATCAGTCTATAGATCACCACCCCCACATCACGCTCCACAGGCCGCTCCTCCTCCACAACCAGCTTCACAACCACCGCCTGGATATGTTACCATAATTCCTGCCCCTAATAGGAA
15 1 2 11 MNC5697470 DV984554, CK437578 GQ0042_H13, GQ0202_K09 GQ0042.BR_H13,GQ0202.B3_K09 MN5176016,MN5233023 UniRef100_Q0J9B4 1.65E-63 Os04g0662800 protein GO:0005515 protein binding GO:0008270 zinc ion binding GO:0004842 ubiquitin-protein ligase activity GO:0005086 ARF guanyl-nucleotide exchange factor activity GO:0005085 guanyl-nucleotide exchange factor activity GO:0005524 ATP binding GO:0016874 ligase activity GO:0000166 nucleotide binding GO:0004888 transmembrane receptor activity GO:0016740 transferase activity GO:0006355 regulation of transcription, DNA-dependent GO:0006512 ubiquitin cycle GO:0006886 intracellular protein transport GO:0006915 apoptosis GO:0030071 regulation of mitotic metaphase/anaphase transition GO:0006952 defense response GO:0007283 spermatogenesis GO:0035023 regulation of Rho protein signal transduction GO:0005622 intracellular GO:0005737 cytoplasm GO:0005794 Golgi apparatus GO:0005680 anaphase-promoting complex GO:0005743 mitochondrial inner membrane GO:0016020 membrane PF04528 7.70E-32 Adenovirus early E4 34 kDa protein conserved region SM00584 3.30E-27 109ultra AAAAACTGCAAAATATTTAATATTGTATGTCCTGTGTCAACTTGGAATAATAAAGAAACAATATATTAGCCAATATTTT*GAAAACAAGGTTAATAAC*TTTGAATCAATAAAGTCTAAACCACAAACCAATGAATACATCAGGGTAGCAGGGTTAGCCTT*GGCTCATAATAAATATGCCTTTGAAATAAAAATATAAATATACAAAATTTACCTCCCCACAGGTGCCCACAAGGGCAGTGGATGCTGAAAAATAGTTACTAGTTTCAGAAACAAATGGATGTACTTGACAAATGGATTTCATATATCCTAAAAGTCAATAACTGTAGGAAAACCCGCATATGTTATTTAGCTTTGCCACCTTTGGCACCCCGTCCTCTTCCACGACCTCTAGCAGCTGTACTGCTTGTATGATCCTTAACTACTTTTTTTCCACTGGATTTACCACGGCCACGACCACGGCTCTTAGTGTTACTCTTGGACGAACCATTTTCACCTTCTTTATAAGTATCATCATCATCGTCATCATCGTCATCATTGTCATCAACATCATTGTCATCACTATTCTCTGTGTCTGACAAATCTTTTTTCTTTGAAACCTTTTTGCGAGGCTTTTTCTCGGCTTTGACAGAAGCTTCAGCAATTGCACCATCAGAACCAGATTTTCGTTTCTTTCCTGATTTAATCGCAGGCTGTTTTTTGTTTGGTATATCCTCCACAACCTCAACCGCAGCTTCTATGGGACTCCTGCCATCATATACATCAAGCTTTTCTATACGATCGCCCATATTTGTTCGGTCAACCACTATAAGGGAGTGTCCAATACCACAAGCAACACTGATAGCATGCATTCCTTCAAGAATATCAATCTTCTTCGGATTTGCCGATGACTTTGGACCTGACGGACCAAATCCAAGTTCTCCATATTGGGCTGTGCCAAAGCCAATAACTGAATCATCAGCACCACATACACTATGTGTATTACCAGAATCCATGCAACGTATTTGCCACCCACTTAAATCAAACACTGGTTTCGGGTACATCCAATTATCAGAAGTCGGCTTCACTTTACCCCACATGTAAAGTTGACCACCTCCTGCAGTGGCTGCAGAGTAAGTGGCACCAGCTGCAATCACAGCCGTAGGAGGAATCAGATTGCTCTTTTGAAAAGTTTCCACAATCCGTGGACTCCACTCATCTTTCTGTTCCTTATGCCCTAGCCTTCCATACCCTCCAAATCCCCATGTGTAAACAAATCCATTGGAGTCCGCTGCAACTGT*GTGATTGTTACCACATGCAACCTTAGTGATTGTTTTTGCTGATAAGGCAGCAATTGCTCGAGGACGAGGTTGTGCTTCATAGGCCAGTTTTACTGTACCCTCTTTTGCATTGTACTCATTGTCTGTTCCATGACCGAGCTGACCGTATTGCGGAAGACCTGCAGTCAAAATAGTAG
16 1 2 15 MNC5690257 CK443886 GQ0015_P03 GQ0015.BR_P03 MN5160338 UniRef100_Q7XDP2 4.48E-55 Inosine triphosphate pyrophosphatase, putative, expressed GO:0016787 hydrolase activity GO:0047429 nucleoside-triphosphate diphosphatase activity GO:0042802 identical protein binding GO:0003723 RNA binding GO:0003968 RNA-directed RNA polymerase activity GO:0017111 nucleoside-triphosphatase activity GO:0000049 tRNA binding GO:0009022 tRNA nucleotidyltransferase activity GO:0016740 transferase activity GO:0004549 tRNA-specific ribonuclease activity GO:0006281 DNA repair GO:0006350 transcription GO:0019079 viral genome replication GO:0008033 tRNA processing GO:0006396 RNA processing GO:0005634 nucleus GO:0005829 cytosol GO:0005737 cytoplasm GO:0019028 viral capsid PF01725 2.50E-69 Ham1 family SM00767 4.80E-23 dcd TTTTATACTTTTTGAAACTATTCCAAAATGCGCCCGAAACCGTAGTATATCATGTTTACTCTTTGCATGTGGGGCAGAGAAACATGGCGGCATCATTGAAGGTGGTAACCTTCGTGACAGGAAATGCTAAGAAGCTGGACGAAGTTCGAAGAATTATCGGCGATACTATACCTTTCCAGTCCGTCAAGCTAGACTTGCCTGAACTACAGGGCGAACCCGAAGACATTTCAAAGGAAAAGGCTCGTCTTGCATCACGACAGATAAACGGCCCAGTGCTTGTGGAAGATACATGCCTCTGTTTCAATGCACTGAAAGGTCTTCCAGGCCCATACATAAAGTGGTTTCTGGAGAAGATTGGCCACGAAGGTCTGAACAATTTGCTTGTGGCTTACGAAGACAAATCTGCTTATGCTCAGTGTGTCTTTTCCCTAGCTCTTGGGCCAGATTCTGAACCATTGACTTTTGTTGGAAGAACTGAGGGAAAAATAGTTCCCCCCAGGGGTCCGCCTACTTT*TGGATGGGATCCTATATTTCAACCTGATGGCTACACACAGACATATGCTGAGATGCCAAAGGAAGAGAAGAATAGAATTTCACATCGTGGAAAAGCTTTGGACAAAGTGAAAGCTCACTTCGCTACTAATATAAATTTGATTGATTGAATGGATCAAATATAATGCAAAATCCTCTTCACACATTTTGAGAGCTGGTTAACTAAGAGCATATCTATTCTGTTTCTTTGATTTTTATCTTGAATGTTATCTATAAATTGTTGTATGATTGCAAAGAAAAATGTATTGTCAACATCAATATGCACCTTAGTACAAAATAAATCTCTTATGACTCTTATAAAAGC
17 1 2 17 MNC5695745 CK439291 GQ0031_O12 GQ0031.TB_O12 MN5164097 UniRef100_Q10PA5 9.61E-20 NHP2-like protein 1, putative, expressed GO:0003723 RNA binding GO:0005515 protein binding GO:0003735 structural constituent of ribosome GO:0008415 acyltransferase activity GO:0016740 transferase activity GO:0016779 nucleotidyltransferase activity GO:0030515 snoRNA binding GO:0030559 rRNA pseudouridylation guide activity GO:0042254 ribosome biogenesis and assembly GO:0000074 regulation of progression through cell cycle GO:0007338 fertilization (sensu Metazoa) GO:0007422 peripheral nervous system development GO:0000398 nuclear mRNA splicing, via spliceosome GO:0030490 processing of 20S pre-rRNA GO:0006412 translation GO:0009058 biosynthetic process GO:0006365 35S primary transcript processing GO:0031118 rRNA pseudouridine synthesis GO:0030529 ribonucleoprotein complex GO:0005634 nucleus GO:0005730 nucleolus GO:0005732 small nucleolar ribonucleoprotein complex GO:0046540 U4/U6 x U5 tri-snRNP complex GO:0005622 intracellular GO:0005840 ribosome PF01248 4.40E-36 Ribosomal protein L7Ae/L30e/S12e/Gadd45 family SM00552 5.50E-25 adara_8 CTTTATATAATGGGCCTGATAACAGAAACTAGGCACTACAGCCAGGAGATTTAAGCATCTCCTGTAATAAGAATGGAAAAAACATATTTTCCGAATATCATTGATTATCCTACAAATGGCATTTTACCATTTTACTCCCATGATGAATAGAGATTTCCAATTATTACCTTCTGAAATGAAAATCACTCAGCTATTCAGGTATTCCGTTCTTTCAAACATTTGTAAAAGCAAACATAGCTGAAAATAGCTAACAAACACAGATCACGCTGGAACAAAAACAAAATCTACAAAACTGGTCTCGATAAATATAAGAGCTCAGTAGCAACACCTCGATGGCCAGCCAACAATCTGAGACTCGGAGGCCAAGTCTTGCAAAAATTCCAAGCCATTGACTTAAAAACCATCAACCCTAAACCCAATGTAGGGCACATTCTGTCCTCTTATATTAGCATATCCTCATCCTCACATGTGCAGATTTTGAATAGCAACCTTGAGCTTGCTTATCCGGGCGTCGAGTCCGCTCCCTATATGTGTCGACATCACAGCGCAGGCAACCACGGGACTAATCACCACTCCACAAGCACGGCCCAGTTCTTGTTTTGATGGCACAAATACATACGGTATTTTCTTAGTTTTAGCCAAGGTTGGCAGATGGAGAACAATGTCCAGAGGCTGTGTGTCCGCCGCTATTATAACAAAGTCTGCTAATCCCCTGTGCAATGTCTTGAAAACTTCATGTGCACCTTTCTTCAGCTGTCTGACCTCAGAAGCATCCCGAACAACTTCTATTATCGATGTGTAGAGCTCGGTATCCGCCAGCGGCTGGGCTTTGGGATTTACATTTACTACTGCTTCTGTGGTCTTGTCCGAGGCATTAGTTGCTGCGCATATGTGGCGAAGAAAGCTACTCCTTGCTGGTTGCATTAACAGATGATGCAGAAGCGATAACTTTGCAATTTGCGTTCCCATTGAAACCCTTCACTAGTCAACACCAACGGTTCCGGCACCGCTCACTTCAGACCCTCGTGCCGAATTCGGCACGAG
18 1 2 19 MNC5697886 CO484512 GQ0205_I09 GQ0205.TB_I09 MN5235936 N/A N/A N/A N/A N/A N/A PF07946 8.60E-20 Protein of unknown function (DUF1682) SM00226 4.30E-17 LMWPc_2 TCTGAGATCTAAAGTGCTTCTTGTCTGCCAAGATCTCTTAAGAATATTATGCTAAAATACAACAGCATGAGATGATCCAAACAGCAACTGCATGCTCAAGAATAATGCTAATAATTACAGATGGCCGTGCTTAAACAGCAAGACAACCAAGAATCTTGCAATATAGATCATGGCCGCTTCTTCCTCTTATTTCTCACACAAAATATTGGAACATAGTGGCAAACAAAATAGCTCACATACAAACAATCTTCACCGTAGCTCTTACAGAAGGGAGATTAAAGCAGATCCAGTAGTGGAGGCTGATCAGAAGGTGGCTTTGCATTACTGTTTCGGGAAGAATTACTAGAAGGGACTTGACTTCTTCCTTTTCCTCTTCCTCTTCCTCTTCCTCTGCCCATTCCAGAAGGTGGAGGTGGAGCAATCTTCAAAGCTGCAGGTTCAGTCTTAGCAGATGCAAATATCGATCCAATATCTAACTGCTGTTGGTTTGCAGTAACAGACAGTGAACCATTTGGCATGCTTGGACTTAAGGTAGACCAGCTCAATGAACTAGTAGGATTTTGCACAGGTGCATTGCCTGAACTTCTCATTGAACCTGCACTACCAATTGAGTCCCTTGATTGATTATTGATTCCACTATTAGTACGTGGGGGCCAGTCAGCAAAAGGATCAAAGTCATCAATGCCAGAGGTTGGTCCAACAGATACATTAGAAAGACCATTAGACATTGATTTCTTGCTTGACGTCTCTTGAAGACCATGATGTCCAAATGACCAACTTCCAT
19 1 3 1 MNC5696520 CK438190, CK438676 GQ0033_G22, GQ0083_I21 GQ0033.TB_G22,GQ0083.TB_I21 MN5164534,MN5174128 UniRef100_Q84UV5 4.27E-50 CSN8 GO:0005515 protein binding GO:0004518 nuclease activity GO:0016787 hydrolase activity GO:0016855 racemase and epimerase activity, acting on amino acids and derivatives GO:0019781 NEDD8 activating enzyme activity GO:0008152 metabolic process GO:0000338 protein deneddylation GO:0005634 nucleus GO:0008180 signalosome complex PF01826 1.30E-21 Trypsin Inhibitor like cysteine rich domain SM00302 4.80E-21 GED_2 AGCTATTCAGGTTAGTCTTAGCTATATTTTCTGTAATCATGCAAATTGCAAATAACCATCAGGGCATTAGTTAAACTCTAGAAAGCATGAGTACACGAATACAGAATGCCATCTCACAACTCTGAACAACTAAAACCTACTTTACTGTCTGTAACATTGCAACCAGTAATATATTTCTAATCCTCCTCAATGCAGTATGCAAAAATGTAACAAAATTCATGG*AGGCCAAAGATAAAGCCTACTTTACCAAGAGGCATCTAAATGCAAAAATATGATTGAAGTTCAAAAAGCCTATTTCGTAACCTGCTCTGAAAAGAATAAAACACAATCAAGAGATGGCCCCAAGGGAGATATCAATGCTCCAAGTGGAAAACGTATTCTGTTAAATTTTGAAGTGTACTAGAATGCAATCTCTGGTCCACAACTGCAGGCATTTTTTTCACAGTGAGCATCTGTGATGCTGAATCAAGAGTCCAACCTCGTTGCAATGTATAAGCCAGTGCATCATCCTTGGACATTCCCAAAAACTGCGCTGTATCAGCCACACTTATCGTGGAATATGCAGCCAATAGTAGCTCAAAAGCCCTTTTTGTGTAACTATCAGATAATGCAGTAATAATCTGCTGCACTTCTGGACTCCAATTGAAGCTATGAAGAGCTCCATGGACGCCTGCATAATCATGTGTCCACATGCACTGACCTATCTTCCACACAGCAACAACTTCAGGCTGACTCTCCTTCACAGACGAAGGCAAGCGCTTCCAGAGAAATCTTGCACTGTTTATATCCTGTGTGTAGATGTGTCCCAGCAGATGAATGCAATACGGCCAACCTTCTGGCTCTTTGATACCTTGAGCGGCCAACTGGAGTTGAAGCTCGTCGCATATATCTGCGATTTTGTCATATTGCTTGGATTCAATGGCTTCTTTGAGCTCCGTCAAGTCCATCATTCTCTTCTCAACGCCCACTTGCTTCGCACTGTCCTCAAAAACTGTCCCTCGTGC
20 1 3 3 MNC5701649 DV972680 GQ00412_A11 GQ00412.B3_A11 MN5258589 UniRef100_Q0Q419 4.72E-80 Class III HD-Zip protein HDZ33 GO:0003700 transcription factor activity GO:0043565 sequence-specific DNA binding GO:0046983 protein dimerization activity GO:0003677 DNA binding GO:0004871 signal transducer activity GO:0006355 regulation of transcription, DNA-dependent GO:0007165 signal transduction GO:0005634 nucleus PF04102 1.60E-20 SlyX SM00593 4.00E-19 893paper3 GCACGAGGCGGCATTGAGACATTTGCGTCAAGTAGCTCAAGAGGTCTCAGGTGAAGTGGTTCTTGGTTGGGGTAGGCAGCCAGCTGCTCTGCGGGCATTTAGCCAGAGACTGTGCAGGGGTTTCAATGATGCTGTGAATGGCTTTGTAGATGATGGTTGGTCTTTGTTGGGTAGTGATGGGGTGGAGGATGTGATCATTGCCATAAATTCATCTCCAAGCAAATTTTTAGGTTCTCAACTTGCTTCTTCTGATGGCATTTCAGCTCTTAATGGGGGCATTCTGTGTGCTAAGGCATCTATGCTATTACAGAACGTGCCTCCAGCATTACTTGTCCGCTTCTTGCGGGAACATCGTTCAGAGTGGGCTGATTGTAATGTTGATGCTTATTCTTCAGCTACCATGAAAGCAAATGCTTACAATGTTCCAGGTTCACTGGGAGGCATTACAGGAAGTCAAGTTATCCTTCCACTGGCACACACTGTGGAACATGAAGAGTTCTTGGAAGTCATCAAACTCGAGGGACAAGGTCTCACACATGAAGAAGCTTTGCTGTCTAAAGATATGTTTCTGTTACAGCTCTGTAGCGGAATAGATGAACATGCAGTTGGATTCTGTGCTCAACTTGTGTTTGCTCCAATTGATGCATCTTTTGCTGATGATGCTCCTCTGCTGCCCTCTGGTTTCCGAGTAATTCCTCTAGAATCTGGATCAGATGCTTCTCCTCCAACCGAACTTTGGATTTAGCTTCTGCTC

Total number of rows: 11036

Table truncated, full table size 14178 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap