NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL10558 Query DataSets for GPL10558
Status Public on Jun 17, 2010
Title Illumina HumanHT-12 V4.0 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description The HumanHT-12 v4 Expression BeadChip provides high throughput processing of 12 samples per BeadChip without the need for expensive, specialized automation. The BeadChip is designed to support flexible usage across a wide-spectrum of experiments.

The updated content on the HumanHT-12 v4 Expression BeadChips provides more biologically meaningful results through genome-wide transcriptional coverage of well-characterized genes, gene candidates, and splice variants.

Each array on the HumanHT-12 v4 Expression BeadChip targets more than 31,000 annotated genes with more than 47,000 probes derived from the National Center for Biotechnology Information Reference Sequence (NCBI) RefSeq Release 38 (November 7, 2009) and other sources.

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://www.ncbi.nlm.nih.gov/projects/geo/info/spreadsheet.html

October 11, 2012: annotation table updated with HumanHT-12_V4_0_R2_15002873_B.txt
 
Submission date Jun 17, 2010
Last update date Aug 13, 2018
Organization Illumina Inc.
E-mail expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (82616) GSM557431, GSM557432, GSM557433, GSM557434, GSM557435, GSM557436 
Series (2423)
GSE20129 Atherosclerosis study using female peripheral blood samples
GSE22427 Effect of T350 phosphorylation on gene repression activity of EZH2 in BJ cells
GSE24896 Global expression analysis of BAP1 knockdown in transfected 92.1 cells
Relations
Alternative to GPL10904
Alternative to GPL22366 (alternative)

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
Species
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Unigene_ID Unigene id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Probe_Id
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome build 36 version 3
Cytoband
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq
Obsolete_Probe_Id Identifier of probe id before bgx time
GB_ACC

Data table
ID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Unigene_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Probe_Id Array_Address_Id Probe_Type Probe_Start SEQUENCE Chromosome Probe_Chr_Orientation Probe_Coordinates Cytoband Definition Ontology_Component Ontology_Process Ontology_Function Synonyms Obsolete_Probe_Id GB_ACC
ILMN_1343048 phage_lambda_genome 5090180 GAATAAAGAACAATCTGCTGATGATCCCTCCGTGGATCTGATTCGTGTAA
ILMN_1343049 phage_lambda_genome 6510136 CCATGTGATACGAGGGCGCGTAGTTTGCATTATCGTTTTTATCGTTTCAA
ILMN_1343050 phage_lambda_genome:low 7560739 CCGACAGATGTATGTAAGGCCAACGTGCTCAAATCTTCATACAGAAAGAT
ILMN_1343052 phage_lambda_genome:low 1450438 TCTGTCACTGTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGC
ILMN_1343059 thrB thrB 1240647 CTTGTGCCTGAGCTGTCAAAAGTAGAGCACGTCGCCGAGATGAAGGGCGC
ILMN_1343061 phage_lambda_genome:mm2 2900397 AATTAAAACGATGCACTCAGGGTTTAGCGCGTAGACGTATTGCATTATGC
ILMN_1343062 phage_lambda_genome:mm2 240255 GAAGCATTCAGAGCAAATGAGGCAGCGTTGGTGTAGCACGATAATAATAT
ILMN_1343063 phage_lambda_genome:mm2 2120427 CGGACGTTATGATTTACCGTGGAAAGATTTGTGAAGTGTTCTGAATGCTC
ILMN_1343064 phage_lambda_genome:mm2 3180440 GCCCCGTATTCAGTGTGGCTGATTTGTATTGTCAGAAGTTGTTTTTACGT
ILMN_1343291 Homo sapiens RefSeq NM_001402.4 ILMN_5311 EEF1A1 NM_001402.5 NM_001402.5 1915 83367078 NM_001402.5 EEF1A1 NP_001393.1 ILMN_1343291 3450719 S 1294 TGTGTTGAGAGCTTCTCAGACTATCCACCTTTGGGTCGCTTTGCTGTTCG 6 - 74284362-74284378:74284474-74284506 6q13c "Homo sapiens eukaryotic translation elongation factor 1 alpha 1 (EEF1A1), mRNA." "All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [evidence IEA]; All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [evidence IEA]; All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [pmid 3512269] [evidence TAS]; That part of the cytoplasm that does not contain membranous or particulate subcellular components [goid 5829] [pmid 10368288] [evidence EXP]; A multisubunit nucleotide exchange complex that binds GTP and aminoacyl-tRNAs, and catalyzes their codon-dependent placement at the A-site of the ribosome. In humans, the complex is composed of four subunits, alpha, beta, delta and gamma [goid 5853] [pmid 2564392] [evidence TAS]" The successive addition of amino acid residues to a nascent polypeptide chain during protein biosynthesis [goid 6414] [evidence IEA]; The successive addition of amino acid residues to a nascent polypeptide chain during protein biosynthesis [goid 6414] [pmid 8812466] [evidence TAS]; The successive addition of amino acid residues to a nascent polypeptide chain during protein biosynthesis [goid 6414] [pmid 15189156] [evidence EXP] "Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Functions in chain elongation during polypeptide synthesis at the ribosome [goid 3746] [evidence IEA]; Catalysis of the reaction: GTP + H2O = GDP + phosphate [goid 3924] [evidence IEA]; Interacting selectively with GTP, guanosine triphosphate [goid 5525] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Functions in chain elongation during polypeptide synthesis at the ribosome [goid 3746] [evidence IEA]; Catalysis of the reaction: GTP + H2O = GDP + phosphate [goid 3924] [evidence IEA]; Interacting selectively with GTP, guanosine triphosphate [goid 5525] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Catalysis of the reaction: GTP + H2O = GDP + phosphate [goid 3924] [evidence IEA]; Interacting selectively with GTP, guanosine triphosphate [goid 5525] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Catalysis of the reaction: GTP + H2O = GDP + phosphate [goid 3924] [evidence IEA]; Interacting selectively with GTP, guanosine triphosphate [goid 5525] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Functions in chain elongation during polypeptide synthesis at the ribosome [goid 3746] [evidence IEA]; Catalysis of the reaction: GTP + H2O = GDP + phosphate [goid 3924] [evidence IEA]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [pmid 17373842] [evidence IPI]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [pmid 15231747] [evidence IPI]; Interacting selectively with GTP, guanosine triphosphate [goid 5525] [pmid 3512269] [evidence TAS]" EEF1A; FLJ25721; CCS-3; PTI1; CCS3; MGC102687; MGC16224; EF-Tu; eEF1A-1; EEF-1; MGC131894; HNGC:16303; GRAF-1EF; LENG7; EF1A EEF1A; PTI1; MGC16224; eEF1A-1; EF-Tu; EEF-1; HNGC:16303; GRAF-1EF; LENG7; EF1A NM_001402.5
ILMN_1343295 Homo sapiens RefSeq ILMN_27206 GAPDH NM_002046.3 NM_002046.3 2597 83641890 NM_002046.3 GAPDH NP_002037.2 ILMN_1343295 4490161 S 937 CTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGGCTGGCATTG 12 + 6517320-6517369 12p13.31d "Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA." "All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures [goid 5737] [evidence NAS]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]" "The chemical reactions and pathways involving glucose, the aldohexose gluco-hexose. D-glucose is dextrorotatory and is sometimes known as dextrose; it is an important source of energy for living organisms and is found free as well as combined in homo- and hetero-oligosaccharides and polysaccharides [goid 6006] [evidence IEA]; The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA]; The chemical reactions and pathways involving glucose, the aldohexose gluco-hexose. D-glucose is dextrorotatory and is sometimes known as dextrose; it is an important source of energy for living organisms and is found free as well as combined in homo- and hetero-oligosaccharides and polysaccharides [goid 6006] [evidence IEA]; The chemical reactions and pathways resulting in the breakdown of a monosaccharide (generally glucose) into pyruvate, with the concomitant production of a small amount of ATP. Pyruvate may be converted to ethanol, lactate, or other small molecules, or fed into the TCA cycle [goid 6096] [evidence NAS]; The process of removal or addition of one or more electrons with or without the concomitant removal or addition of a proton or protons [goid 55114] [evidence IEA]" "Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA]; Catalysis of the reaction: D-glyceraldehyde 3-phosphate + phosphate + NAD+ = 3-phospho-D-glyceroyl phosphate + NADH + H+ [goid 4365] [evidence IEA]; The selective, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule [goid 5488] [evidence IEA]; Interacting selectively with nicotinamide adenine dinucleotide, a coenzyme involved in many redox and biosynthetic reactions; binding may be to either the oxidized form, NAD, or the reduced form, NADH [goid 51287] [evidence IEA]; Catalysis of the reaction: D-glyceraldehyde 3-phosphate + phosphate + NAD+ = 3-phospho-D-glyceroyl phosphate + NADH + H+ [goid 4365] [pmid 3170585] [evidence NAS]; Catalysis of the reaction: D-glyceraldehyde 3-phosphate + phosphate + NAD+ = 3-phospho-D-glyceroyl phosphate + NADH + H+ [goid 4365] [pmid 7030790] [evidence NAS]; Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [pmid 17540579] [evidence IPI]; Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced [goid 16491] [evidence IEA]; Interacting selectively with nicotinamide adenine dinucleotide, a coenzyme involved in many redox and biosynthetic reactions; binding may be to either the oxidized form, NAD, or the reduced form, NADH [goid 51287] [evidence IEA]" G3PD; GAPD; MGC88685 GAPD; MGC88685; G3PD NM_002046.3
ILMN_1343296 permuted_negative 5960452 GTGCCTGTTGACACTTTCGGTTGTGTTGTTCCAAACCCTCACTATGCTGC
ILMN_1343297 permuted_negative 4670040 ACTGTAAGAAGACCCAAAGGCACCCTAGCTAGAGCCCTCCCGAGTGGTGG
ILMN_1343298 permuted_negative 6280026 CTTTGTACTCAGGCCCACCCCCCTCTAGTTGTTTCTTTACATAAATGTTC
ILMN_1343299 permuted_negative 2470411 ACTACTGAGTTAAGAGTAAAGACCTGTTAGTAGTGCGTCCAACTGCAGCT
ILMN_1343300 permuted_negative 6400180 CATACGCCGTGTGCACTCCCTGGCTTAGAGCATAGGAAGAGTAATAAGAA
ILMN_1343301 permuted_negative 2680364 GGTAAGGGGATTTGGGTGCGACCAACAAGGGGTAGAACAAAGTGGTGAGT
ILMN_1343302 permuted_negative 6940653 TGCGAGTGGAGGCAGACCGGTAGGGGAATGCTAAAGGGAATTGACAAGAG
ILMN_1343303 permuted_negative 3610711 GGAGCCGATAGATATGGGGCCGACCTGGGCCGGAAACATAGAGCGATACT
ILMN_1343304 permuted_negative 2900575 TGGTTCGGCTTTCAGCAGGCTTGCCTTATTCTGACTTGCCTTCCCAACCC

Total number of rows: 48107

Table truncated, full table size 70356 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL10558_HumanHT-12_V4_0_R1_15002873_B.txt.gz 13.1 Mb (ftp)(http) TXT
GPL10558_HumanHT-12_V4_0_R2_15002873_B.txt.gz 13.1 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap