NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL10334 Query DataSets for GPL10334
Status Public on Apr 15, 2010
Title Agilent-026657 Whole Rat Genome Microarray 4x44K v2 (Feature Number version)
Technology type in situ oligonucleotide
Distribution commercial
Organism Rattus norvegicus
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description Rat Design content refresh 44k

Arrays of this design have barcodes that begin with 16026657 or 2526657.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

 
Submission date Apr 15, 2010
Last update date Apr 15, 2010
Organization Agilent Technologies
E-mail cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 

Data table header descriptions
ID Agilent feature number
COL Column
ROW Row
NAME NAME
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBankAccession
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence

Data table
ID COL ROW NAME SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
1 266 170 GE_BrightCorner GE_BrightCorner pos
2 266 168 DarkCorner DarkCorner pos
3 266 166 DarkCorner DarkCorner pos
4 266 164 DarkCorner DarkCorner pos
5 266 162 DarkCorner DarkCorner pos
6 266 160 DarkCorner DarkCorner pos
7 266 158 DarkCorner DarkCorner pos
8 266 156 DarkCorner DarkCorner pos
9 266 154 DarkCorner DarkCorner pos
10 266 152 DarkCorner DarkCorner pos
11 266 150 DarkCorner DarkCorner pos
12 266 148 A_42_P707230 A_42_P707230 FALSE NM_017132 NM_017132 29218 Rcn2 reticulocalbin 2, EF-hand calcium binding domain Rn.6133 ENSRNOT00000021817 ref|NM_017132|ens|ENSRNOT00000021817|gb|BC061962|gb|U15734 chr8:59659348-59659407 rn|8q24 Rattus norvegicus reticulocalbin 2, EF-hand calcium binding domain (Rcn2), mRNA [NM_017132] GO:0005509(calcium ion binding)|GO:0005783(endoplasmic reticulum)|GO:0005788(endoplasmic reticulum lumen) TGATGAAGCTGTCAGTTTTCGTTCTTGTACTCGTAGACTTCCTTTTGAAACTGACGAAGG
13 266 146 A_64_P121469 A_64_P121469 FALSE XM_001070381 XM_001070381 ENSRNOT00000042604 ens|ENSRNOT00000042604|ens|ENSRNOT00000042551|ref|XM_001070381|ref|XM_577318 chr14:15557760-15557701 rn|14p22 PREDICTED: Rattus norvegicus similar to DNA segment, Chr 5, ERATO Doi 577, expressed (predicted) (RGD1564102_predicted), mRNA [XM_001070381] TCCAGCATCTCAGTATGTTTTGCCCCCATTTTCTTAGAGATCACATGAGTCAAGTCCTAG
14 266 144 A_64_P120901 A_64_P120901 FALSE XM_001081294 XM_001081294 688146 LOC688146 similar to radical S-adenosyl methionine domain containing 1 ref|XM_001081294 unmapped PREDICTED: Rattus norvegicus similar to radical S-adenosyl methionine domain containing 1 (LOC688146), mRNA [XM_001081294] GO:0003824(catalytic activity)|GO:0004109(coproporphyrinogen oxidase activity)|GO:0005737(cytoplasm)|GO:0006779(porphyrin biosynthetic process)|GO:0051536(iron-sulfur cluster binding)|GO:0055114(oxidation reduction) TTGGACTCCTTGTTATTGACCCTCCTGCCTCAACTCCAAGAGGCCTGGCAGCACAGGACT
15 266 142 A_64_P033346 A_64_P033346 FALSE NM_001000002 NM_001000002 287245 Olr1398 olfactory receptor 1398 Rn.107042 ENSRNOT00000041540 ref|NM_001000002|ens|ENSRNOT00000041540|tc|TC604924 chr10:34940924-34940983 rn|10q22 Rattus norvegicus olfactory receptor 1398 (Olr1398), mRNA [NM_001000002] GO:0004872(receptor activity)|GO:0004984(olfactory receptor activity)|GO:0007186(G-protein coupled receptor protein signaling pathway)|GO:0007608(sensory perception of smell)|GO:0016021(integral to membrane)|GO:0050911(detection of chemical stimulus involved in sensory perception of smell) ATGGATCGTCGACTACAAACACCGATGTACTTCTTCCTTAACAACCTCTCTTTTCTGGAC
16 266 140 A_42_P666065 A_42_P666065 FALSE NM_001014069 NM_001014069 313588 Snip1 Smad nuclear interacting protein 1 Rn.8811 ENSRNOT00000037510 ref|NM_001014069|ens|ENSRNOT00000037510|gb|BC087118|tc|TC575798 chr5:144416503-144416562 rn|5q36 Rattus norvegicus Smad nuclear interacting protein 1 (Snip1), mRNA [NM_001014069] GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0007249(I-kappaB kinase/NF-kappaB cascade) TGTAGATCCGCATCCTCTGAGGATTCCTGATTGCTCCATGAAGCAGACATAATGGTTTGA
17 266 138 NA NA ignore
18 266 136 A_42_P547629 A_42_P547629 FALSE NM_001106718 NM_001106718 298890 Fam49a family with sequence similarity 49, member A Rn.36104 ENSRNOT00000007701 ref|NM_001106718|ens|ENSRNOT00000007701|gb|BC158700|tc|TC598001 chr6:35936374-35936433 rn|6q14 Rattus norvegicus family with sequence similarity 49, member A (Fam49a), mRNA [NM_001106718] GO:0005622(intracellular) TTCAGTAGAACCCTGCTCAGAGAGGAGGATCTGTGCTGACCTCAGATGTATATGTTTACA
19 266 134 A_64_P134089 A_64_P134089 FALSE XM_001059872 XM_001059872 295284 Rbm8 RNA binding motif protein 8 Rn.37716 gb|XM_215637|ref|XM_001059872|gb|BF557946 chr2:191432126-191432185 rn|2q34 PREDICTED: Rattus norvegicus RNA binding motif protein 8 (predicted) (Rbm8_predicted), mRNA [XM_215637] GO:0000166(nucleotide binding)|GO:0000184(nuclear-transcribed mRNA catabolic process, nonsense-mediated decay)|GO:0003729(mRNA binding)|GO:0005634(nucleus)|GO:0005681(spliceosomal complex)|GO:0005737(cytoplasm)|GO:0006397(mRNA processing)|GO:0006417(regulation of translation)|GO:0006810(transport)|GO:0008380(RNA splicing)|GO:0016607(nuclear speck)|GO:0051028(mRNA transport) AGTTTATGTGGTCTCCGGAATTAAAACATGGAGCTCTGAGATGCTCAGCCAGCTCTACTT
20 266 132 A_64_P120280 A_64_P120280 FALSE XM_001077411 XM_001077411 310859 RGD1311625 similar to KIAA1546 protein Rn.141338 ENSRNOT00000046775 ens|ENSRNOT00000046775|gb|XM_227694|ref|XM_001077411|gb|CB547311 chr2:231016132-231016073 rn|2q43 PREDICTED: Rattus norvegicus similar to KIAA1546 protein (predicted) (RGD1311625_predicted), mRNA [XM_227694] ACCGTGACTACAAGGCCATATGCTTTCACTCAGGTCACAGGGCCTTACAACACATATGTA

Total number of rows: 45220

Table truncated, full table size 25563 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap