NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL10094 Query DataSets for GPL10094
Status Public on Mar 02, 2010
Title Agilent-020186 C. elegans (V2) Gene Expression Microarray (Feature Number version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Caenorhabditis elegans
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description Caenorhabditis elegans (Nematode) Oligo Microarray

Arrays of this design have barcodes that begin with 16020186 or 2520186.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

*** A different version of this platform with the Agilent Probe names in the ID column is assigned accession number GPL11346
 
Submission date Feb 22, 2010
Last update date Dec 06, 2012
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (393) GSM767758, GSM767759, GSM767760, GSM767761, GSM767762, GSM767763 
Series (28)
GSE30977 C. elegans: Dauers and Dauer-Exit at 12 hour time-point vs. Mix-stage worms
GSE36413 C. elegans young adults: Exposed to Bacillus thuringiensis DB27 versus exposed to E. coli OP50 : 4 hours
GSE36493 C. elegans immune response to Staphylococcus aureus, 4 hour exposure
Relations
Alternative to GPL11346

Data table header descriptions
ID Agilent feature number
COL Column
ROW Row
NAME NAME
SPOT_ID Spot identifier
CONTROL_TYPE Control type
GB_ACC GenBank or RefSeq accession
LOCUSLINK_ID Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence

Data table
ID COL ROW NAME SPOT_ID CONTROL_TYPE GB_ACC LOCUSLINK_ID GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID ACCESSION_STRING CHROMOSOMAL_LOCATION DESCRIPTION GO_ID SEQUENCE
1 266 170 GE_BrightCorner GE_BrightCorner pos
2 266 168 DarkCorner DarkCorner pos
3 266 166 DarkCorner DarkCorner pos
4 266 164 DarkCorner DarkCorner pos
5 266 162 DarkCorner DarkCorner pos
6 266 160 DarkCorner DarkCorner pos
7 266 158 DarkCorner DarkCorner pos
8 266 156 DarkCorner DarkCorner pos
9 266 154 DarkCorner DarkCorner pos
10 266 152 DarkCorner DarkCorner pos
11 266 150 DarkCorner DarkCorner pos
12 266 148 A_12_P150300 FALSE NM_001027380 175659 rrt-1 aRginyl aa-tRNA syntheTase Cel.17117 wb|F26F4.10b.1|wb|F26F4.10b.2|wb|F26F4.10a.2|wb|F26F4.10a.1 chrIII:4914443-4914384 rrt-1 encodes an arginyl-tRNA synthetase that affects embryonic viability and fertility [Source: WormBase] [F26F4.10b.1] GO:0000166(nucleotide binding)|GO:0002119(nematode larval development)|GO:0004812(aminoacyl-tRNA ligase activity)|GO:0004814(arginine-tRNA ligase activity)|GO:0005524(ATP binding)|GO:0005737(cytoplasm)|GO:0006412(translation)|GO:0006418(tRNA aminoacylation for protein translation)|GO:0006420(arginyl-tRNA aminoacylation)|GO:0009792(embryonic development ending in birth or egg hatching)|GO:0040007(growth)|GO:0040010(positive regulation of growth rate)|GO:0040019(positive regulation of embryonic development) TGGCCACTCTGTTCCACGACTTCTACAACGAGTGTTACGTTATTGAAAATAAGGAAGGAG
13 266 146 A_12_P133604 FALSE NM_001038332 3896780 K03H6.6 hypothetical protein Cel.37657 wb|K03H6.6|ref|NM_001038332 chrIV:1545411-1545352 Putative uncharacterized protein; [Source:UniProtKB/TrEMBL;Acc:Q4R124] [K03H6.6] CTTCCGGAGGAAAATCCTGCAAACAATTTGTATATTTTGTGCGTGTTATTTTCTCATTCC
14 266 144 A_12_P159775 FALSE tc|TC138485 chrV:12623827-12623768 CAGGTTCATCGGCTGGAAATTGATATTTAAGATATGGGTTCTAAGAAGAGCGTTTTCTAA
15 266 142 A_12_P177079 FALSE NM_073631 187659 R07B7.12 hypothetical protein Cel.2868 wb|R07B7.12a|ref|NM_073631|tc|TC149742 chrV:12091698-12091757 UPF0392 protein R07B7.12; [Source:UniProtKB/Swiss-Prot;Acc:Q21802] [R07B7.12a] GO:0016021(integral to membrane) AGAAATGTACCCGATCACTTTCCATTATGCAGTTCATCCATTTTGGTCGAATGACATTGG
16 266 140 A_12_P109691 FALSE NM_058966 259373 C11D9.1 hypothetical protein Cel.19240 wb|C11D9.1|ref|NM_058966|tc|TC138879 chrI:4425966-4426025 Putative uncharacterized protein; [Source:UniProtKB/TrEMBL;Acc:O01847] [C11D9.1] GO:0005089(Rho guanyl-nucleotide exchange factor activity)|GO:0005622(intracellular)|GO:0035023(regulation of Rho protein signal transduction) TCGAGAATCACATCGTCCATTAAGTGGATCTAGTCAATCGGATGGTGGTTATGTGTCAGA
17 266 138 A_12_P140847 FALSE NM_072896 Cel.21806 wb|K06C4.5|ref|NM_072896 chrV:8897562-8897503 his-17 encodes an H3 histone. his-17 is contained within the histone gene cluster HIS4. [Source: WormBase] [K06C4.5] CCTAAATTTCTGATTTTCAGAGTTTGAGACCGTTTCGATTCAAACCCCCACCGAACCCAA
18 266 136 A_12_P157256 FALSE NM_066747 182353 clec-162 C-type LECtin Cel.34038 ref|NM_066747 chrIII:9723746-9723292 Caenorhabditis elegans C-type LECtin family member (clec-162) (clec-162) mRNA, complete cds [NM_066747] GO:0005488(binding) ACAGCTAGGGGAAATGGATCATCAGTAGCCGAGGAGCTCAATTCAAATTCAAAGGAAAAA
19 266 134 A_12_P137370 FALSE NM_001129563 6418794 Y37H2A.13 hypothetical protein Cel.37690 wb|Y37H2A.13|ref|NM_001129563|gb|FM251385 chrV:18143359-18143417 Protein Y37H2A.13, confirmed by transcript evidence; [Source:UniProtKB/TrEMBL;Acc:A5PEY1] [Y37H2A.13] GGAATGATTGTTCGCACAGAGGACATCAACTTGTCGATGCTTCATAGTTCTTTAATCTTG
20 266 132 A_12_P108125 FALSE NM_001027838 176806 cul-2 CULlin Cel.21341 ref|NM_001027838|gb|U58084|tc|TC143871 chrIII:13690983-13691536 Caenorhabditis elegans CULlin family member (cul-2) (cul-2) mRNA, complete cds [NM_001027838] GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0006511(ubiquitin-dependent protein catabolic process)|GO:0007138(meiotic anaphase II)|GO:0008054(cyclin catabolic process)|GO:0008105(asymmetric protein localization)|GO:0008595(determination of anterior/posterior axis, embryo)|GO:0009792(embryonic development ending in birth or egg hatching)|GO:0031461(cullin-RING ubiquitin ligase complex)|GO:0031625(ubiquitin protein ligase binding)|GO:0042078(germ-line stem cell division)|GO:0051232(meiotic spindle elongation)|GO:0051759(sister chromosome movement towards spindle pole during meiosis II) CGTCGCGAATACTTTCCAGGTTTCACAAGACCGAAAGTACTATATGGAGTGCGCAATTGT

Total number of rows: 45220

Table truncated, full table size 19864 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL10094_old_annotations.txt.gz 5.9 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap