NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL10017 Query DataSets for GPL10017
Status Public on Feb 06, 2010
Title WUSTL Yersinia pestis 15K array
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Yersinia pestis
Manufacturer Genome Sequencing Center, Washington University School of Medicine
Manufacture protocol Oligos were synthesized using standard methods by Illumina (San Diego, CA). The oligonucleotides were dissolved at a concentration of 50 μM in 3X SSC with 0.75M betaine and were printed in triplicate on Corning Epoxy slides by a locally constructed linear servo arrayer.
 
 
Submission date Feb 05, 2010
Last update date May 14, 2010
Contact name Chris Minion
E-mail(s) fcminion@iastate.edu
Phone 515-294-6347
Fax 515-294-8500
Organization name Iowa State University
Department VMPM
Street address 1130 Vet Med
City Ames
State/province IA
ZIP/Postal code 50011
Country USA
 
Samples (18) GSM506961, GSM506962, GSM506963, GSM506964, GSM506965, GSM506966 
Series (4)
GSE20217 Transcriptional analysis of quorum sensing null strain in Yersinia pestis CO92 at 30°C
GSE30108 LuxS/AI-2 quorum sensing microarray comparison in Yersinia pestis at 30°C
GSE30109 3 quorum sensing signals add in microarray comparison in Yersinia pestis at 30°C

Data table header descriptions
ID
IDS
Gene Function
SEQUENCE
ORF
GB_ACC
SPOT_ID

Data table
ID IDS Gene Function SEQUENCE ORF GB_ACC SPOT_ID
1 YPO0222a YPO0222a rpsN 3.A.2 228059 228364 30S ribosomal protein S14 CAAACTGGTCGTCCTCATGGTTTCCTGCGGAAGTTCGGGTTGAGCCGTATTAAAGTCCGTGAAACCGCTA YPO0222a
2 YPO0228 YPO0228 rplO 3.A.2 230405 230839 50S ribosomal protein L15 TGAAAGTTATACTTTCAGGCGAAGTCAATCGTGCGGTAACTCTTCGTGGTCTGCGAGTCACCAAAGGCGC YPO0228
3 YPO0245a YPO0245a ----- 5.I 243738 244310 conserved hypothetical protein CCGTTAGTGTCAACTAGCGCTAATTTAAGTGGGCATGAGCCGTGCCGCACGGAAGAAGAAGTCAGAATAC YPO0245a
4 YPO0253 YPO0253 acs 1.A.1 250732 252690 acetyl-coenzyme A synthetase ATGCGCCGTATTTTACGCAAAATTGCGACAGGAGATACCAGCAACTTGGGCGATACCTCAACACTTGCCG YPO0253
5 YPO0269 YPO0269 ----- 4.A.6 269617 270537 type III secretion system apparatus protein GGCCGTGGCAGTTTACTCCGGTGCGATGAAAAACTGGTGGTCAGAATTGCACAATGGGGATTACAAAACG YPO0269
6 YPO0275 YPO0275 ----- 5.I 275051 275320 conserved hypothetical protein ATTCTCCATCCGTAGAAACACCCCAACTGGCAGCGCCTATTGTGCCTGATTATCGCCTCGATATGGTGGG YPO0275
7 YPO0293 YPO0293 ----- 5.I 294300 295361 conserved hypothetical protein GCTTTGACCGTACCGATAATCGTGTTGTTCACCCAGATCTCTATCTGGCCGCTCTTGAGCGCACTGAAAA YPO0293
8 YPO0299 YPO0299 terE 5.D 299787 300362 tellurium resistance protein AAATTGCTCGCTTTGACCTATCCGAGGATGCCAGTACTGAAACCGCCATGATCTTTGGCGAGCTATACCG YPO0299
9 YPO0623 YPO0623 ----- 5.I 684175 685407 putative aminotransferase GCAAATCTTTGAGCGCCGCCGTAAGGTAGTGTTTGAGATGATGAATGCGATTCCTGGCGTATGCATGGTG YPO0623
10 YPO0629 YPO0629 ----- 5.I 689361 689663 conserved hypothetical protein GGTATTCCCCATGTAAATGGGAAGATATTTTTGGTAAACGAAGCCCTATCACAGCTCGATCGCGCGCCCA YPO0629
11 YPO0649 YPO0649 bacA 4.H 706363 707181 putative bacitracin resistance protein TGGCCGCAGAATGGTTGAAACCTAAAAATCCTAAGGCTGTCGGGCTGGATGATATTACCTACCGTCAGGC YPO0649
12 YPO0655 YPO0655 asoB_ yjeH 4.A 715677 716927 putative permease GTTGCCATCGCTTTTGGTCCGAAACTGGGTAAAGTCACGGGCTGGCTATTTTTATCGGTTATTCCGGTCG YPO0655
13 YPO0673 YPO0673 sufI 4.C 734264 735688 putative cell division protein TATGAACCGAGTAGATGTGCAGGCTCAGCAGGGGACATGGGAGCGTTGGATAATACATGCTGATATGCCA YPO0673
14 YPO0680 YPO0680 ----- 3.C.1 742154 742816 putative DedA-family membrane protein TACGTTTTCAGTTATTTAATTGGCTAAGCGGCCTGCTGTGGGTTGGCAGCGTCGTGGGTTTGGGTTTTGC YPO0680
15 YPO0701 YPO0701 ----- 4.A 762990 764003 periplasmic binding protein CGCTGGCCAATGTGCCAGACACGCTGAAGGACAACACCCATACAGAGCACCGTAAAGATATCATTCAGTT YPO0701
16 YPO0708 YPO0708 fliQ 4.D 770790 771059 putative flagellar assembly protein GATTAATGAACAAACGCTGAGCTTTTTACCGCGCCTGGTCATGACAATGTTGGTTCTCATCTTTGCGGGT YPO0708
17 YPO1037 YPO1037 ----- 5.I 1178213 1178545 conserved hypothetical protein GGCAAACCGTCCCACCGGAAGCAGAAGCTTTTGAGAGTAACGAGCCTTTTAGTATTGATACTATGGCGGC YPO1037
18 YPO1043 YPO1043 ampM_ map_ b0168 3.A.8 1184138 1184929 methionine aminopeptidase TTAAACCGGGGATCCGCCTGCGGACGCTGGGTAAAGCTATCCAGAAATTTGTTGAAGCAGAGAACTTCTC YPO1043
19 YPO1061 YPO1061 ----- 5.I 1205517 1205915 conserved hypothetical protein GCGCTAAAAGAACTTGTCGTCGCGGGCGTTGTTTGCGAAGCAGTTCGCATTGATCCCTACACTCAATCAC YPO1061
20 YPO1066 YPO1066 ----- 5.I 1209358 1209774 conserved hypothetical protein CGGGCGCAGGGCGCTGGAGGCCAGCATGTTAATAAAACCTCAACTGCGATTCATTTGCGCTTTGACATTA YPO1066

Total number of rows: 15360

Table truncated, full table size 2196 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap