Format

Send to:

Choose Destination

Links from PubMed

    • Showing Current items.

    mir-58.1 ncRNA [ Caenorhabditis elegans ]

    Gene ID: 260181, updated on 12-Oct-2017
    Gene symbol
    mir-58.1
    Gene description
    ncRNA
    Locus tag
    CELE_Y67D8A.4
    Gene type
    ncRNA
    Organism
    Caenorhabditis elegans (strain: Bristol N2)
    Lineage
    Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis
    Location:
    chromosome: IV
    Exon count:
    1
    Sequence:
    Chromosome: IV; NC_003282.8 (3233254..3233350)

    Chromosome IV - NC_003282.8Genomic Context describing neighboring genes Neighboring gene ncRNA Neighboring gene Uncharacterized protein Neighboring gene ncRNA Neighboring gene ncRNA Neighboring gene ncRNA Neighboring gene DM (Doublesex/MAB-3) Domain family

    GeneRIFs: Gene References Into FunctionsWhat's a GeneRIF?

    Expression pattern

    • This gene is expressed at high level at all stages of development, embryos, L1, L2, L3, L4 larvae and aduts\; it is expressed at least in the soma, since the transcript is also found in large amounts in germ-line defective glp-4 animals [reviewed by Bartel D, Lau N, Lim L, oct 2003]

    Molecular properties

    • [Ambros et al, RNA 2003] MicroRNAs (miRNAs) are small noncoding RNA gene products 20 to 25 nt long that are processed by Dicer (with 5'-phosphate and 3'-hydroxyl) from single stranded precursors with a characteristic hairpin secondary structure. They cannot reliably be distinguished from other RNAs such as small interfering RNAs also processed by Dicer, through their function or structure, but they can through a combination of expression properties: a distinct ~22-nt RNA transcript should be detectable by hybridization to a size-fractionated RNA sample\; biogenesis : MicroRNAs come from a single-molecule fold-back (hairpin) structure, not a hybrid between two antiparallel transcripts, and finally, in organisms with reduced Dicer function, increased precursor accumulation should occur. In the best cases, phylogenetic conservation of the ~22-nt miRNA sequence and its predicted fold-back precursor secondary structure is observed across distant species.
    • [Wormbase] mir-58 encodes a microRNA, a small non-protein coding RNA and is conserved in C. briggsae\; mir-58 is expressed constitutively throughout development in normal worms and in glp-4(bn2) adults\; many of the known microRNAs are involved in post-transcriptional regulation of genes\; the precise function of mir-58 is not known.
    • [This gene is annotated in collaboration with Nelson Lau and David Bartel] The mature miRNA sequence UGAGAUCGUUCAGUACGGCAAU originates from the 3' end of the stem-loop sequence GCTCGTCATATCCATTGCCCTACTCTTCGCATCTCATCACTTCGTCCAATACCATAGGGATGAGATCGTTCAGTACGGCAATGGACTGAGCTAGAGT. The actual transcript is not known. The miRNA stem-loop sequence displayed corresponds to the foldback structure used to find and define the miRNAs and their homologs in other species. This miRNA is exactly conserved in C. briggsae (100\% identity).

    Genome Annotation

    The following sections contain reference sequences that belong to a specific genome build. Explain

    Reference assembly

    Genomic

    1. NC_003282.8 Reference assembly

      Range
      3233254..3233350
      Download
      GenBank, FASTA, Sequence Viewer (Graphics)

    RNA

    1. NR_000454.2 RNA Sequence

      Status: REVIEWED

    Support Center