Updating Information on GenBank Records

You can update your existing GenBank records at any time using the different file types described below. If you are updating multiple records, please send a list of all accessions to be updated at the top of your request. You can also request a change in the release date of your records, depending on their status. Save the update file types as plain text and mail to gb-admin@ncbi.nlm.nih.gov.

Do not submit a new file to update an existing record as this will create unnecessary duplication in the database.

If you submitted to our collaborators at ENA or DDBJ, please see their instructions for update formats. Prokaryotic and eukaryotic genomes, TSA and SRA should be updated as described on the linked pages. Updates to BioProject and BioSample should be sent to submit-help@ncbi.nlm.nih.gov.

Update Formats for GenBank Records:

Editing Source Information

Send updates to the source information (i.e. strain, cultivar, country, specimen_voucher) in a multi-column tab-delimited table, for example:

acc. num.       strain  country organism
MHxxxx02        82      USA Escherichia coli
MHxxxx03        ABC     Canada  Bacillus subtilis

Updating Publication Information

[a] If the PMID or DOI are publicly available please send the information as a tab-delimited table as follows:

    acc. num.   PMID 
    MHXXXX01    29980901
    MHXXXX02    29980901

or

    acc. num.   DOI
    MHXXXX01    10.1000/xyz123
    MHXXXX02    https://doi.org/10.1000/xyz123doi

[b] For all other updates, please provide the revised information in a tab-delimited table. You must replace any non-ASCII characters (for example, characters with accents and umlauts) with the appropriate English letters.

The complete list of revised author names should be provided in the following format: first_initial middle_initial surname, etc., For example:

    acc. num.    authors    title
    MHXXXX01    J. A. Smith    Identification of gene A               
    MHXXXX02    X. P. Weng, J. Doe    Identification of gene B

These are the valid publication fields which should be used in the column headers:

  • authors
  • journal
  • volume
  • issue
  • pages
  • publication date
  • title
  • affiliation
  • department
  • city
  • state
  • publication country
  • street
  • postal code
  • *PMID
  • **class

All columns may not be appropriate for each reference. Use only the relevant columns. If the reference has been published, include the complete journal title, not an abbreviation.

*If the publication has a PubMed identifier (PMID), it is not necessary to supply any of the remaining publication fields. It is sufficient to send a table with accession number and PMID only.

**The class descriptor should only be used when the publication status has been changed. This descriptor has a controlled vocabulary and may only include one of the following three class values:

  • unpublished
  • in-press journal
  • journal

Nucleotide Sequence Update

If you are updating the current nucleotide sequence send the complete new sequence(s) in fasta format:

>MHxxxx02
cggtaataatggaccttggaccccggcaaagcggagagac
>MHxxxx03
ggaccttggaccccggcaaagcggagagaccggtaataat

Please do not send a list of nucleotide changes. Do not include non-IUPAC characters within the sequence. Use n's for unknown nucleotides within the sequence.

Feature Update

If you are adding annotation or changing locations of features, then send us the features as a tab-delimited 5-column Feature table.

a. If the record is publicly released and has annotation, you can download the existing annotation .tbl file by retrieving the record and clicking on the 'Send to' option. Choose 'File' as Destination and then Format 'Feature table'. Edit this table and send to us via email.

b. If the record is not yet publicly released, let us know, and we will send you a 5-column table with the current annotation for you to edit and return to us.

Please maintain the tab structure of the table when editing.

For example:

>Feature gb|EFxxxxxx|EFxxxxxx
<1      400     gene
                        gene            ENO1
<1      30      CDS
70      300
                        product         enolase
                        note            homodimer
<1      30      mRNA
70      400
                        product         enolase
<1      30      exon
                        number          1
70      400     exon
                        number          2
Support Center

Last updated: 2021-06-22T14:16:20Z