txid2846071[Organism:exp] - GEO DataSets

Select item 2001926481.

Rubella Virus wildtype and vaccine strains induce transcription of chemokines and components of innate immunity in human embryonic endothelial cells

(Submitter supplied) We describe the transcriptional response to infection of human umbilical vein endothelial cells (Huvec) with different rubella virus strains

Organism:: Rubivirus rubellae; Homo sapiens

Type:: Expression profiling by high throughput sequencing; Other

Platforms:: GPL31148 GPL20301
48 Samples

Download data: FA, TSV

Series

Accession:: GSE192648

ID:: 200192648

Select item 2001041482.

Characterization of rubella-specific humoral immunity following two doses of MMR vaccine using proteome microarray technology

(Submitter supplied) This study uses proteome microarray technology/data to identify predictive biomarkers of neutralizing antibody response and potential new correlates of protective immunity in rubella virus serology.

Organism:: Homo sapiens; Rubella virus vaccine strain RA27/3

Type:: Protein profiling by protein array

Platform:: GPL24038
150 Samples

Download data: CSV

Series

Accession:: GSE104148

ID:: 200104148

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 1000311483.

Illumina HiSeq 4000 (Rubivirus rubellae)

Organism:: Rubivirus rubellae

1 Series
6 Samples

Download data

Platform

Accession:: GPL31148

ID:: 100031148

Select item 1000240384.

Rubella virus-specific proteome microarray chip (Antigen Discovery, Inc., Irvine, CA)

(Submitter supplied) cDNAs were created by RT-PCR from Rubella virus/RV (strain RA27/3, Taxonomy ID) infected cells (total RNAs were extracted using the Qiagen RNeasy Plus mini kit and PCR was performed using the Novagen’s KOD Hot Start DN Polymerase kit/Cat # 71086). The following RV-specific primers were used: for envelope glycoprotein 1/E1 RubE1-F gaggaggctttcacctacctctgca and RubE1-R gcgcggcgctatagcgc; for envelope glycoprotein 2/E2 RubE2-F gggctccagccccgcgct and RubE2-R gccataggcgggggggttgt ; for capsid protein/CP RubC-F atggcttctactacccccatcaccatgga and RubC-R ggcgcgcgcggtgcc ; for nonstructural protein P150 Rub150-F atggagagactcctagatgaggttc and Rub150-R gacagggggaccgcg ; for nonstructural protein P90 RubP90-F cggggcggtggcacc and RubP90-R tagtcagcgtcgtggagattggc. more...