nsv3085068
- Organism: Homo sapiens
- Study:nstd144 (Gardner et al. 2017)
- Variant Type:mobile element insertion
- Method Type:Sequencing
- Submitted on:GRCh37 (hg19)
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: No
- Region Size:1
- Description:
TSD=AAGAAGCCAGGTGTATATATTT;MEINFO=L1Ambig,-1,6019,+ - Publication(s):Gardner et al. 2017
Source: NCBI
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 92 SVs from 25 studies. See in: genome view
Overlapping variant regions from other studies: 92 SVs from 25 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Score | Assembly | Assembly Unit | Reciprocity | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|---|---|
| nsv3085068 | Remapped | Perfect | GRCh38.p12 | Primary Assembly | First Pass | NC_000005.10 | Chr5 | 156,192,876 | 156,192,876 |
| nsv3085068 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000005.9 | Chr5 | 155,619,886 | 155,619,886 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis |
|---|---|---|---|
| nssv14079306 | line1 insertion | Sequencing | Split read and paired-end mapping |
Variant Call Placement Information
| Variant Call ID | Placement Type | Score | HGVS | Assembly | Reciprocity | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|---|---|
| nssv14079306 | Remapped | Perfect | NC_000005.10:g.156 192876_156192877in s? | GRCh38.p12 | First Pass | NC_000005.10 | Chr5 | 156,192,876 | 156,192,876 |
| nssv14079306 | Submitted genomic | NC_000005.9:g.1556 19886_155619887ins ? | GRCh37 (hg19) | NC_000005.9 | Chr5 | 155,619,886 | 155,619,886 |
No validation data were submitted for this variant
No clinical assertion data were submitted for this variant
Genotype Information
| Variant Call ID | Allele Frequency (AF) |
|---|---|
| nssv14079306 | 0.28 |