Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000020.3(ACVRL1):c.1378-615_1378-614insGTTGATGAGCTTCCTGGGATGA

Help
Interpretation:
Benign​

Review status:
criteria provided, single submitter
Submissions:
1 (Most recent: Dec 11, 2020)
Last evaluated:
Aug 14, 2019
Accession:
VCV000993738.1
Variation ID:
993738
Description:
22bp insertion
Help

NM_000020.3(ACVRL1):c.1378-615_1378-614insGTTGATGAGCTTCCTGGGATGA

Allele ID
981817
Variant type
Insertion
Variant length
22 bp
Cytogenetic location
12q13.13
Genomic location
12: 51920144-51920145 (GRCh38) GRCh38 UCSC
12: 52313928-52313929 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
LRG_543:g.17727_17728insGTTGATGAGCTTCCTGGGATGA
NC_000012.11:g.52313928_52313929insGTTGATGAGCTTCCTGGGATGA
NC_000012.12:g.51920144_51920145insGTTGATGAGCTTCCTGGGATGA
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000012.12:51920144::GTTGATGAGCTTCCTGGGATGA
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Benign 1 criteria provided, single submitter Aug 14, 2019 RCV001285650.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
ACVRL1 Sufficient evidence for dosage pathogenicity No evidence available GRCh38
GRCh37
573 584

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Benign
(Aug 14, 2019)
criteria provided, single submitter
Method: clinical testing
Telangiectasia, hereditary hemorrhagic, type 2
Allele origin: germline
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories
Accession: SCV001472118.1
Submitted: (Dec 11, 2020)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Record last updated Oct 08, 2021