Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_000243.3(MEFV):c.374AGGGGAACG[3] (p.125EGN[3])

Help
Interpretation:
Conflicting interpretations of pathogenicity​

Pathogenic(1);Uncertain significance(3)

Review status:
criteria provided, conflicting interpretations
Submissions:
6 (Most recent: Jul 4, 2021)
Last evaluated:
Oct 16, 2019
Accession:
VCV000097521.9
Variation ID:
97521
Description:
9bp microsatellite
Help

NM_000243.3(MEFV):c.374AGGGGAACG[3] (p.125EGN[3])

Allele ID
103413
Variant type
Microsatellite
Variant length
9 bp
Cytogenetic location
16p13.3
Genomic location
16: 3254676-3254677 (GRCh38) GRCh38 UCSC
16: 3304677-3304685 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000016.10:g.3254679TTCCCCTCG[3]
NC_000016.9:g.3304679TTCCCCTCG[3]
NM_000243.3:c.374AGGGGAACG[3] MANE Select NP_000234.1:p.125EGN[3]
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000016.10:3254676:CGTTCCCCTCGTTCCCCTCG:CGTTCCCCTCGTTCCCCTCGTTCCCCTCG
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA280598
dbSNP: rs104895121
Varsome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Uncertain significance 4 criteria provided, multiple submitters, no conflicts Oct 16, 2019 RCV000083773.4
Uncertain significance 1 criteria provided, single submitter Dec 7, 2017 RCV000598725.1
Pathogenic 1 criteria provided, single submitter May 1, 2017 RCV001090252.1
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
MEFV No evidence available No evidence available GRCh38
GRCh37
674 722

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Uncertain significance
(Dec 07, 2017)
criteria provided, single submitter
Method: clinical testing
not specified
Allele origin: germline
GeneDx
Accession: SCV000710216.1
Submitted: (Mar 26, 2018)
Evidence details
Comment:
The c.383_391dupAGGGGAACG variant has been reported previously in the Infevers database. The variant is observed in 1/9714 (0.01%) alleles from individuals of Ashkenazi Jewish background … (more)
Uncertain significance
(May 28, 2019)
criteria provided, single submitter
Method: clinical testing
Familial Mediterranean fever
Allele origin: unknown
Mendelics
Accession: SCV001139893.1
Submitted: (Oct 22, 2019)
Evidence details
Uncertain significance
(Oct 16, 2019)
criteria provided, single submitter
Method: clinical testing
Familial Mediterranean fever
Allele origin: germline
Invitae
Accession: SCV001394201.2
Submitted: (Jan 07, 2021)
Evidence details
Comment:
This variant, c.383_391dup, results in the insertion of 3 amino acid(s) to the MEFV protein (p.Glu128_Asn130dup), but otherwise preserves the integrity of the reading frame. … (more)
Pathogenic
(May 01, 2017)
criteria provided, single submitter
Method: clinical testing
not provided
Allele origin: germline
CeGaT Praxis fuer Humangenetik Tuebingen
Accession: SCV001245678.5
Submitted: (Jul 04, 2021)
Evidence details
Uncertain significance
(Sep 16, 2020)
no assertion criteria provided
Method: clinical testing
Familial Mediterranean fever
Allele origin: germline
Natera, Inc.
Accession: SCV001457156.1
Submitted: (Dec 28, 2020)
Evidence details
not provided
(-)
no assertion provided
Method: not provided
Familial Mediterranean fever
Allele origin: not provided
Unité médicale des maladies autoinflammatoires, CHRU Montpellier
Accession: SCV000115869.1
Submitted: (Jun 07, 2010)
Evidence details

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
There are no citations in ClinVar for this variation. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs104895121...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Aug 27, 2021